Skip to content

Advertisement

  • Research article
  • Open Access

Arsenic trioxide induces cell cycle arrest and affects Trk receptor expression in human neuroblastoma SK-N-SH cells

Biological Research201851:18

https://doi.org/10.1186/s40659-018-0167-6

  • Received: 14 November 2017
  • Accepted: 6 June 2018
  • Published:

Abstract

Background

Arsenic trioxide (As2O3), a drug that has been used in China for approximately two thousand years, induces cell death in a variety of cancer cell types, including neuroblastoma (NB). The tyrosine kinase receptor (Trk) family comprises three members, namely TrkA, TrkB and TrkC. Various studies have confirmed that TrkA and TrkC expression is associated with a good prognosis in NB, while TrkB overexpression can lead to tumor cell growth and invasive metastasis. Previous studies have shown that As2O3 can inhibit the growth and proliferation of a human NB cell line and can also affect the N-Myc mRNA expression. It remains unclear whether As2O3 regulates Trks for the purposes of treating NB.

Methods

The aim of the present study was to investigate the effect of As2O3 on Trk expression in NB cell lines and its potential therapeutic efficacy. SK-N-SH cells were grown with increasing doses of As2O3 at different time points. We cultured SK-N-SH cells, which were treated with increasing doses of As2O3 at different time points. Trk expression in the NB samples was quantified by immunohistochemistry, and the cell cycle was analyzed by flow cytometry. TrkA, TrkB and TrkC mRNA expression was evaluated by real-time PCR analysis.

Results

Immunohistochemical and real-time PCR analyses indicated that TrkA and TrkC were over-expressed in NB, and specifically during stages 1, 2 and 4S of the disease progression. TrkB expression was increased in stage 3 and 4 NB. As2O3 significantly arrested SK-N-SH cells in the G2/M phase. In addition, TrkA, TrkB and TrkC expression levels were significantly upregulated by higher concentrations of As2O3 treatment, notably in the 48-h treatment period. Our findings suggested that to achieve the maximum effect and appropriate regulation of Trk expression in NB stages 1, 2 and 4S, As2O3 treatment should be at relatively higher concentrations for longer delivery times;however, for NB stages 3 and 4, an appropriate concentration and infusion time for As2O3 must be carefully determined.

Conclusion

The present findings suggested that As2O3 induced Trk expression in SK-N-SH cells to varying degrees and may be a promising adjuvant to current treatments for NB due to its apoptotic effects.

Keywords

  • Arsenic trioxide
  • Neuroblastoma
  • Cell cycle
  • Trk expression

Background

Neuroblastoma (NB) is an extracranial solid tumor that is frequently encountered in children and accounts for 8–10% of malignancies [1]. Despite the use of intensive chemotherapy, the 5-year event-free survival is 30%, and remains unsatisfactory in the high-risk and refractory NB patient subgroup [2]. The main treatment for NB includes combined chemotherapy, radiotherapy and surgery. However, despite improvements in disease progression via intensification of therapy and efforts to treat minimal residual disease, more than 50% of patients will relapse and die from their malignancies [3]. Relapsed or refractory NB responds poorly to conventional treatments and has a lower survival rate [4]. In recent years, new therapies, such as auto-hematopoietic stem cell transplantation (auto-HSCT), targeting and biological immunotherapy treatment, have been used somewhat effectively in patients with relapsed or refractory NB [5]; however, the efficacy remains unsatisfactory. Therefore, it is essential to identify new drugs or treatment strategies that are more efficient and result in a lower incidence of toxic side effects.

Although arsenic trioxide (As2O3) is a drug that has been used in China for approximately 2000 years [6], its clinical application is limited due to its potential toxicity. In 1992, Hongde et al. [7]. demonstrated that As2O3 could be highly effective in the treatment of acute promyelocytic leukemia (APL), and increasing studies have shown that it can induce complete remission, even in patients with relapsed APL, at low doses and with minimal general toxicity [8]. In other studies, As2O3 has been shown to exert cytotoxic effects on a variety of tumors, such as lung cancer [9], nasopharyngeal carcinoma [10], osteosarcoma [11], neurogliocytoma [12], hepatoma [13], cervical cancer [14], cholangiocarcinoma [15], breast cancer [16], gastric cancer [17] and ovarian cancer [18]. These effects have been documented in vitro and in vivo. Recent studies have also shown that the growth and proliferation of a human NB cell line could be inhibited by As2O3 in a dose- and time-dependent manner and that N-myc mRNA levels could also be affected [19]. Moreover, As2O3 inhibited NB xenograft growth in nude mice [20]. Consequently, we hypothesized that As2O3 could feasibly be combined with existing chemotherapeutic modalities in order to establish a new alternative treatment strategy for high-risk NB patients [20]; however, to date, there have been no reports suggesting that As2O3 can be a valid alternative drug for NB clinical treatment.

NB is characterized by clinical heterogeneity and the complexity of genetic abnormalities [21]. Recently, molecular markers, including tyrosine kinase receptors (Trks), have been shown to be capable of transforming immortalized neurons. These proteins are involved in processes such as cell differentiation, proliferation, survival and death, treatment tolerance, invasion and genetic stability [22]. The expression of various members of the Trk family at different stages is clearly related to the prognosis and outcome of NB patients [23]. In NB, the Trk family of neurotrophin receptors, which includes TrkA, TrkB and TrkC, plays a prominent role in the biological behavior and efficacy of response-related gene regulation. The activation of TrkA-I isoforms and downstream signaling by nerve growth factor (NGF) ultimately leads to the apoptosis and differentiation of NB cells [24, 25]. Numerous studies have confirmed that elevated TrkA expression in NB tumor specimens is associated with a good prognosis [25]. TrkB is activated in NB via the endogenous expression of brain-derived neurotrophic factor (BDNF), and increased TrkB expression is an indicator of poor disease prognosis, since TrkB overexpression can lead to tumor cell growth and metastasis [26]. TrkC is a high-affinity receptor for neurotrophin-3 (NT-3), and exogenous NT-3 signals promote cellular apoptosis and differentiation [27]. In the current study, a favorable NB (stage 1/2/4S) was characterized by high levels of TrkA and TrkC expression, while the malignant (or aggressive) form (stage 3/4) was reported to overexpress TrkB [28].

Although As2O3 has been associated with complicated anticancer mechanisms, including the induction of tumor cell differentiation, the inhibition of tumor cell growth and the induction of apoptosis, its efficacy in different tumors remains unclear. In APL cells, As2O3 exerts anti-tumor effects by acting on the PML/RARA fusion protein [29]. Furthermore the anti-tumor effects of As2O3 have been associated with the activation of the caspase cascade, leading to apoptotic cell death and reduced expression of the Bcl-2 gene [30]. Gwak et al. [31]. demonstrated that As2O3 induced increases in p53 levels and decreases in cylinB1 levels combined with cell cycle arrest at the G2/M phase in U87MG and T98G glioblastoma cell lines. Qin et al. [32]. reported that As2O3 enhanced FOXO3a expression and p27kip1 transcription and that it may participate in the regulation of the growth of human hepatoma cells.

In the present study, immunohistochemical analysis was performed in order to examine the expression and distribution of the Trk family members during various stages of NB in children. We then examined the impact of As2O3 on the survival and cell cycle of NB cells. Finally, we used real-time RT-PCR in order to study changes in TrkA, TrkB and TrkC expression levels in NB cell lines following As2O3 treatment. The present study aimed to improve our understanding regarding the trend of TrkA, TrkB and TrkC gene expression in NB cell lines treated with As2O3. The findings provide experimental evidence regarding the exploration of the feasibility of As2O3 use in clinical NB treatment and can aid the assessment of chemotherapy efficacy and of long-term survival in NB children.

Methods

Specimens

A total of 12 NB samples from patients attending the Memorial Hospital of Sun Yat-sen University were evaluated. The diagnosis of NB in these patients was reviewed by our histopathologist, and the clinical staging was assessed using the International Neuroblastoma Staging System (INSS) [33]. The present study was approved by the Institutional Ethics Committee of the Memorial Hospital of the Sun Yat-sen University. Patients and their legal guardians signed informed consent agreements to permit the use of their tumor tissue in this research.

Immunohistochemistry

Consecutive 3-µm sections were cut from every block, and an immunoperoxidase technique was implemented following antigen retrieval by either microwave treatment (95 °C), pepsin (DAKO; Agilent Technologies, Inc., Santa Clara, CA, USA) treatment for 20 min and/or citrate buffer (pH 6.0) treatment for 45 min. Following endogenous peroxidase blocking with 3% H2O2-methanol for 15 min, the specimens were rinsed with phosphate-buffered saline (PBS) for 3 times. Anti-TrkA, anti-TrkB and anti-TrkC antibodies (Abcam, Cambridge, UK) were diluted to 0.5 µg/mL and were used as primary antibodies. Following 12 h incubation at room temperature, the specimens were rinsed with PBS three times and treated for an hour at room temperature with the secondary antibody [peroxidase-conjugated anti-mouse or anti-rabbit antibody (Sigma-Aldrich; Merck KGaA, Darmstadt, Germany)] that was diluted to 0.5%. The probes were subsequently rinsed with PBS 3 times and staining was performed using diaminobenzidine (DAB) solution (DAKO). Following drying, the samples were counterstained with Meyer hematoxylin (Sigma-Aldrich). The immunostaining of all samples was conducted under the same conditions as the antibody reaction and DAB exposure. The evaluation of Trk expression was performed by observing 20 microscope fields at ×100 magnification (Santa Cruz Biotechnology, Inc., Dallas, TX, USA).

Assessment of immunohistochemical staining

The staining intensity was scored on a scale of 1–3 as follows: 0 (absent), 1 (weak), 2 (moderate), or 3 (strong). The percentage of tumor cells that indicated positive staining was further assessed semi-quantitatively. The histochemical score (H-score) of immunoreactivity was obtained by multiplying the intensity and the percentage of positive cells, which yielded a final score of 0–300 [34]. The median expression level was selected as a cut-off value in order to classify the samples as positive or negative.

Cell culture

Human SK-N-SH cells were obtained from the Medical School of the Sun Yat-sen University. The cells were maintained in Dulbecco’s modified Eagle’s medium/Nutrient Mixture F-12 Ham (DMEM/F12, 1:1 mixture) (Hyclone; GE Healthcare Life Sciences, Logan, UT, USA) supplemented with 10% heat-inactivated fetal bovine serum (Hyclone) at 37 °C in a 5% CO2 incubator.

Experimental groups

To examine the effects of As2O3 on the cell cycle and the expression levels of Trk, SK-N-SH cells were divided into two treatment groups, and both groups were exposed to 4 µM As2O3 for 48 h. A medium sample devoid of As2O3 was used as a control. To determine the effects on gene expression, the cells were cultured at three different concentrations, namely, 1, 2 and/or 4 µM of As2O3 (10 mg, Beijing double-aigrettes pharmacy, China)., along with a control group for 24 and 48 h [2].

Cell cycle distribution analysis

The cells were seeded into 6-well plates at a density of 2.5 × 105 cells/well in 3 mL of medium and cultured overnight. Following serum starvation for 24 h, the cells were cultivated with half maximal inhibitory concentrations (IC50s) of As2O3 for 24 or 48 h in a 37 °C CO2 incubator. The cells were harvested by trypsinization, washed twice with PBS and fixed with cold 70% ethanol overnight. The samples were stained with propidium iodide (PI) solution containing 50 μg/mL RNase A and 0.1% Triton X-100. The cell cycle distribution was assessed using a flow cytometer (FCM-2012, BD, USA).

Total RNA isolation

Following As2O3 treatment for 48 or 72 h, total RNA was isolated from SK-N-SH cell lines using the TRIzol reagent (Bio. Basic, Shanghai, China) according to the manufacturer’s protocol. The RNA was precipitated with isopropanol, washed with 75% ethanol, and dissolved in diethylpyrocarbonate (DEPC)-treated water. The integrity and purity of total RNA were assessed by DNA gel (1% agarose gel) electrophoresis and UV detection.

Multiplex RT-PCR analysis

Following cDNA synthesis, PCR amplification was performed in order to examine the number of Trk transcripts. The assay was carried out using a Biometra T-gradient Thermoblock thermal cycler (Gottingen, Germany; Table 1). Multiplex RT-PCR was conducted in a final volume of 50 μL with 2× PCR-mix containing 200 μM dNTPs, 5% dimethyl sulfoxide (DMSO), 0.02 U HotStart Taq DNA polymerase (Qiagen GmbH, Hilden, Germany), and 50 pmol of each primer pair. The initial PCR cycle included activation of the polymerase at 95 °C for 5 min, which was followed by 35 cycles of PCR amplification (denaturation at 95 °C for 1 min, annealing at 55 °C for 1 min, and elongation at 72 °C for 1 min) and 1 cycle of elongation at 72 °C for 7 min prior to cooling at 4 °C. The primer sequences are listed in Table 1. The products from the multiplex RT-PCR were confirmed by specific Trks using individual PCRs, which were performed separately using the specific primers for each Trk. The conditions for the individual PCRs were identical to those of the multiplex reactions.
Table 1

Primer sequences and expected PCR product lengths in the multiplex PCR protocol

Gene

Size (bp)

Upstream primer (5′–3′)

Downstream primer (5′–3′)

TrkA

570

TCCAACACGGAGGCAATC

CCAGGACATCCAGGTAGACAG

TrkB

472

TCCGAGATTGGAGCCTAACAG

CCACCAGGATCAGTTCAGACA

TrkC

628

CAAGCCCACCCACTACAACA

GTGGGACTCACTTCGTCAAAC

Statistical analysis

Each experiment was performed at least three times. The data are presented as the mean ± standard deviation (SD). All data were analyzed by Student’s t test using the SPSS 17.0 statistical software package (SPSS, Chicago, IL, USA); a P value lower than 0.05 (P < 0.05) was considered statistically significant.

Results

Specimens

The pediatric Sun Yat-sen Memorial Hospital database resulted in the identification of 12 patients diagnosed with NB; nine were stage 4 and three were stage 2. Since the three children with stage 2 disease had lower N-myc amplification, they were classified as intermediate risk, whereas the remaining of the subjects was classified as high risk according to the INSS criteria.

Neurotrophin receptor expression in NB samples

We performed immunohistochemical analyses of Trk expression in the 12 children with NB. The distribution of Trks was tissue-specific and correlated with the clinical heterogeneity of NB. TrkA expression was present in five (41.7%) tumors, with two (66.7%) stage 2 and three (33.3%) stage 4 tumors showing TrkA expression. A total of 11 (91.7%) tumors expressed TrkB, with two (66.7%) stage 2 and nine (100%) stage 4 tumors. Four (33.3%) tumors exhibited TrkC expression and were divided into two (66.7%) stage 2 and two (22.2%) stage 4 tumors. It is interesting to note that both TrkA (66.7%) and TrkC (66.7%) were strongly co-expressed in stage 2 samples, although they indicated low co-expression in stage 4 samples. Furthermore, TrkB (100%) was highly expressed in advanced-stage disease (stage 4), whereas it was expressed to a relatively lower extent (66.7%) in early-stage NB (stage 2) (Fig. 1).
Fig. 1
Fig. 1

Trk expression in neuroblastoma pathological tissue. Immunohistochemical analyses of TrkA, TrkB TrkC expression. Immunoreactive labeling for TrkA (a), TrkB (c) and TrkC (e) was observed in the cytoplasm of NB cells. In the control cells, TrkA (b), TrkB (d) and TrkC (f) expression was observed. Original magnification ×200. Bar 100 µm

As2O3 induces G2/M phase arrest

Different chemotherapeutic agents have various mechanisms by which they affect cell cycle phases, including the blockade of G1-S and G2/M checkpoints, the proliferative arrest, the onset of DNA repair and the activation of programmed cell death. We analyzed the cell cycle distribution of As2O3-treated SK-N-SH cells by flow cytometry. The cells were treated with 4 µM of As2O3 for 48 h, and the results of the cell cycle analyses are shown in Fig. 2. The percentage of G0/G1-phase cells decreased from 76.27% in control cells to 44.13% in cells treated with 4 µM As2O3. Concomitantly, the percentage of G2/M phase cells in the group treated with 4 μM As2O3 (30.93%) was significantly higher (P < 0.01) than that noted in the control group (5.29%). These data suggested that As2O3 induced apoptosis of SK-N-SH cells following cell cycle arrest at the G2/M phase (Fig. 2).
Fig. 2
Fig. 2

As2O3-induced S-G2/M arrest in NB cells. The effect of As2O3 on cell cycle distribution in SK-N-SH cells was investigated by flow cytometry following 48 h of treatment. The percentages of the cells in the various stages of the cell cycle were quantified

As2O3 affects Trk mRNA expression in SK-N-SH cells

The mRNA expression levels of TrkA, TrkB and TrkC were subsequently analyzed by RT-PCR (Fig. 3). TrkA, TrkB and TrkC were all expressed in SK-N-SH cells. TrkA levels were significantly increased in cells treated with 1 µM As2O3 for 48 h compared with those treated for 24 h (P < 0.01). In contrast to the 1 μM dose of As2O3, TrkA was downregulated following 2 and 4 µM As2O3 treatment. This trend was increased at the 48-h period compared with the 24-h period of treatment (Fig. 3a). Additional results demonstrated that the TrkB gene was expressed mainly in stage 3 and 4 malignant NB cells, which is consistent with previous studies [3]. TrkB expression in SK-N-SH cells increased 2.14-fold following treatment with 1 μM of As2O3 at 48 h, whereas 4 μM treatment caused a 2.96-fold increase in expression (P < 0.01) compared with that of the control group. As2O3 increased TrkB mRNA expression in a dose-dependent manner at 24 and 48 h. In addition, RT-PCR analyses indicated that TrkC expression levels were significantly higher in SK-N-SH cells treated with 4 µM As2O3 for 48 h (5.22 ± 0.90) compared with untreated cells (1.00 ± 0.41, P < 0.01) (Fig. 3b).
Fig. 3
Fig. 3

As2O3 enhances the expression of Trk genes in SH-N-SH Cells. RT-PCR was performed to analyze the mRNA expression levels of Trk genes. RT-PCR was performed on SK-N-SH cells that were treated with 0, 1, 2 or 4 µM As2O3 for 24 or 48 h. The data shown were compiled from three independent experiments

Discussion

The possible prognostic factors related to the clinical behavior of NB have been identified by recent studies [35]. Trks, with their respective neurotrophin ligands, have been strongly correlated with clinical outcomes [36]. The function of these receptors is associated with the survival and differentiation of neurons in the nervous system [37]. Immunohistochemical staining for Trk expression in NB tumors demonstrated that TrkA and TrkC were expressed more prominently in stage 2 tissues. Moreover, TrkB was expressed in all stage 4 tissues, and only in some of the earlier stage tissues. Unfortunately, the present study used a low sample number and did not permit the assessment of the statistical significance of Trk distribution in tissues from different stages. Similarly, Hoehner et al. [38] assessed Trk expression at the mRNA level by real-time PCR assays and reported that TrkA and TrkC expression correlated with favorable outcomes and early stage tumor progression. TrkB was expressed in homogenates of late-stage NB patients with poor prognoses. The authors of this study postulated that in low-stage NB, TrkA and/or TrkC responsiveness may play a role in persistent tumor growth and/or regression [39]. The findings indicated that, TrkA, TrkB and TrkC should be considered new prognostic markers for NB.

As2O3 has been effectively used as a therapeutic agent to treat solid tumors and acts through the induction of cell cycle arrest or apoptosis [40]. Suppression of cell growth by As2O3 can be explained in part by its capacity to affect cell cycle distribution. Ruggeri et al. [41]. reported that low As2O3 concentrations (4 µM) induced rapid induction of apoptosis in NB cells at a rate of more than 50% in less than 16 h. Moreover, kinase activity significantly increased in those cells treated with 4 µM As2O3. The present study demonstrated that the treatment of SK-N-SH cells with 4 µM As2O3 for 48 h induced arrest at the G2/M phase. Our preliminary results (data not shown here) showed that the apoptosis rates of SK-N-SH cells during different time periods of As2O3 treatment were higher than those of the control cells. A similar study was performed by Woo et al. [42],who used SH-SY5Y and SK-N-AS NB cells co-cultured with As2O3. Both cell lines were arrested at the S-G2/M phase and this effect was associated with increased cyclin B expression and CDK1 activity [42, 43]. Other studies observed that the effect of As2O3 on cell cycle progression in NB cells may be related to the p53 status [44] and the micro-protein polymerization. These findings suggested that As2O3 could arrest the cell cycle by modulating the expression and/or activity of several key G2/M regulatory proteins [45]. Furthermore, the activation of caspases occurred solely in As2O3-induced mitotic cells only, as opposed to interphase cells [46], suggesting that As2O3 has a higher cytotoxicity against NB cells that are arrested at the G2/M phase. In addition, the capacity of enhancing treatment outcomes by arresting cells during the S phase of the cell cycle via the combination of As2O3 and chemotherapy should be considered.

Chemotherapeutics arrest the tumor cell cycle and further influence the expression of certain genes that closely correlate with cancer stage and prognosis [47]. The present study is the first to demonstrate that As2O3 can influence TrkA, TrkB and TrkC expression in a time- and dose-dependent manner. We further demonstrated that increasing As2O3 concentrations caused significant upregulation of TrkA and TrkC expression levels. This observation was more obvious at the 48 h compared with the 24 h time point. In human NBs, TrkA is involved in the inhibition of cell growth, the induction of apoptosis, the inhibition of angiogenesis and the determination of either apoptosis and/or differentiation [48]. The selective synthetic TrkA tyrosine kinase inhibitor 5C3 directly binds to the extracellular domain of TrkA and promotes receptor phosphorylation and activation of the PI3K pathway, which leads to NB cell apoptosis [49]. One report indicated that TrkC expression in tumors is often associated with favorable prognosis, suggesting that TrkC acts as a tumor suppressor and/or as a dependence receptor, regulating neuronal survival [39]. High levels of TrkA and TrkC expression in NB patients were associated with favorable prognosis; therefore, the data of the present study suggest that any treatment of NB at stages 1, 2 and 4S should maintain high levels of TrkA and TrkC expression. Furthermore, the therapeutic concentration and the duration of As2O3 treatment should be increased.

The receptor TrkB is preferentially expressed in NB patients who have a poor prognosis and confers invasive and metastatic potential to tumor cells in addition to enhancing therapeutic resistance [50]. We further demonstrated that TrkB expression in SK-N-SH cells was inversely proportional to the concentration of As2O3, with the level of TrkB in the group treated with 4 µM for 48 h being significantly less than that in the control group. Increased TrkB expression is believed to be associated with aggressive NB. Zhang et al. [51] demonstrated that TrkB-expressing NB cells can block cisplatin-induced cell death. Cimmino et al. [52] reported that the BDNF-mediated activation of TrkB enhanced the invasiveness and migration of NB cells in vitro, an effect that could be impaired by the transient transfection of a Gal-1-specific siRNA or a neutralizing antibody directed against Gal-1. Taken together, the data suggest that TrkB downregulation is a potential therapeutic target for refractory or relapsed NB. Our findings further suggested the use of As2O3 for the treatment of stage 3 and stage 4 NB, which indicate high levels of TrkB expression and poor prognoses; an appropriate concentration and treatment time for As2O3 remains to be determined.

Abbreviations

As2O3

arsenic trioxide

NB: 

neuroblastoma

Trks: 

tyrosine kinase receptors

auto-HSCT: 

auto-hematopoietic stem cell transplantation

APL: 

acute promyelocytic leukemia

NGF: 

nerve growth factor

BDNF: 

brain-derived neurotrophic factor

NT-3: 

neurotrophin-3

INSS: 

International Neuroblastoma Staging System

PBS: 

phosphate-buffered saline

IC50s: 

50% inhibitory concentrations

PI: 

propidium iodide

DMSO: 

dimethyl sulfoxide

Declarations

Authors’ contributions

XX—Study design, literature research, experimental studies, data acquisition, data analysis/interpretation, manuscript preparation, manuscript editing. YL—Study concepts, study design, manuscript revision. LL—literature research, study design, data analysis. KQ—Experimental, studies, data analysis, statistical analysis. CZ—Experimental studies, data analysis. YC—Data analysis/interpretation, manuscript editing. JF—Study concepts, study design, manuscript revision. All authors read and approved the final manuscript.

Acknowledgements

This work was supported by the Grant 2014A030313024 from the Guang Dong Natural Science Foundation and a grant from the Guangdong Science and Technology Department (2015B050501004).

Competing interests

The authors declare that they have no competing interests. All authors have reviewed the final version of the manuscript and approve it for publication.

Availability of supporting data

The data set supporting the results of this article is included within the article.

Ethics approval and consent to participate

All procedures performed in studies involving human participants were in accordance with the ethical standards of the institutional and/or national research committee and with the 1964 Helsinki declaration and its later amendments or comparable ethical standards. Chinese Institutional Ethics Committee approval number is ChiCTR1800014748.

Publisher’s Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Open AccessThis article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated.

Authors’ Affiliations

(1)
Guangdong Provincial Key Laboratory of Malignant Tumor Epigenetics and Gene Regulation, Sun Yat-Sen Memorial Hospital, Sun Yat-Sen University, Guangzhou, 510120, China
(2)
Pediatric Hematology/Oncology, Sun Yat-Sen Memorial Hospital, Sun Yat-Sen University, Guangzhou, 510120, China
(3)
Department of Pediatric Hematology/Oncology, Affiliated Hospital of Guangdong Medical College, Zhanjiang, 524000, Guangdong, China
(4)
Department of Life Sciences, Sun Yat-Sen University, Guangzhou, 510120, Guangdong, China

References

  1. Han W, Wang HM. Refractory diarrhea: a paraneoplastic syndrome of neuroblastoma. World J Gastroenterol. 2015;21(25):7929–32.View ArticlePubMedPubMed CentralGoogle Scholar
  2. Bagatell R, Cohn SL. Genetic discoveries and treatment advances in neuroblastoma. Curr Opin Pediatr. 2016;28(1):19–25.View ArticlePubMedPubMed CentralGoogle Scholar
  3. Kushner BH, Ostrovnaya I, Cheung IY, et al. Lack of survival advantage with autologous stem-cell transplantation in high-risk neuroblastoma consolidated by anti-GD2 immunotherapy and isotretinoin. Oncotarget. 2016;7(4):4155–66.View ArticlePubMedGoogle Scholar
  4. Zhu J, Wang J, Zhen ZJ, et al. Brain metastasis in children with stage 4 neuroblastoma after multidisciplinary treatment. Chin J Cancer. 2015;34(3):49.View ArticlePubMed CentralGoogle Scholar
  5. La Quaglia MP. State of the art in oncology: high risk neuroblastoma, alveolar rhabdomyosarcoma, desmoplastic small round cell tumor, and POST-TEXT 3 and 4 hepatoblastoma. J Pediatr Surg. 2014;49(2):233–40.View ArticlePubMedGoogle Scholar
  6. Breccia M, Lo-Coco F. Arsenic trioxide for management of acute promyelocytic leukemia: current evidence on its role in front-line therapy and recurrent disease. Expert Opin Pharmacother. 2012;13(7):1031–43.View ArticlePubMedGoogle Scholar
  7. Xu Y, Chen X, Lin L, et al. Localization of human telomere repeat binding factor 1 in telomerase-positive and-negative cells and its expression during cell cycle. Biochimie. 2017;139:1–8.View ArticlePubMedGoogle Scholar
  8. Ma H, Yang J. Insights into the all-trans-retinoic acid and arsenic trioxide combination treatment for acute promyelocytic leukemia: a meta-analysis. Acta Haematol. 2015;134(2):101–8.View ArticlePubMedGoogle Scholar
  9. Xie SL, Yang MH, Chen K, et al. Efficacy of arsenic trioxide in the treatment of malignant pleural effusion caused by pleural metastasis of lung cancer. Cell Biochem Biophys. 2015;71(3):1325–33.View ArticlePubMedGoogle Scholar
  10. Nakaoka T, Ota A, Ono T, et al. Combined arsenic trioxide-cisplatin treatment enhances apoptosis in oral squamous cell carcinoma cells. Cell Oncol (Dordr). 2014;37(2):119–29.View ArticleGoogle Scholar
  11. Chen J, Wei H, Cheng J, et al. Characteristics of doxorubicin-selected multidrug-resistant human leukemia HL-60 cells with tolerance to arsenic trioxide and contribution of leukemia stem cells. Oncol Lett. 2018;15(1):1255–62.PubMedGoogle Scholar
  12. Zhao HB, Sun QX, Chen XF, et al. Efficacy of intratumoral chemotherapy using arsenic trioxide (As2O3) sustained release tablets for the treatment of neurogliocytoma in nude mice. Eur Rev Med Pharmacol Sci. 2014;18(17):2453–9.PubMedGoogle Scholar
  13. Che JB, Liu ZH, Ma HB, et al. Influence of As2O3 combined with ginsenosides Rg3 on inhibition of lung cancer NCI-H1299 cells and on subsistence of nude mice bearing hepatoma. Asian Pac J Trop Med. 2014;7(10):772–5.View ArticlePubMedGoogle Scholar
  14. Wang H, Gao P, Zheng J. Arsenic trioxide inhibits cell proliferation and human papillomavirus oncogene expression in cervical cancer cells. Biochem Biophys Res Commun. 2014;451(4):556–61.View ArticlePubMedGoogle Scholar
  15. Ling S, Feng T, Ke Q, et al. Metformin inhibits proliferation and enhances chemosensitivity of intrahepatic cholangiocarcinoma cell lines. Oncol Rep. 2014;31(6):2611–8.View ArticlePubMedGoogle Scholar
  16. Kim MJ, Jung JH, Lee WS, et al. Arsenic hexoxide enhances TNF-α-induced anticancer effects by inhibiting NF-κB activity at a safe dose in MCF-7 human breast cancer cells. Oncol Rep. 2014;31(5):2305–11.View ArticlePubMedGoogle Scholar
  17. Gao YH, Zhang HP, Yang SM, et al. Inactivation of Akt by arsenic trioxide induces cell death via mitochondrial-mediated apoptotic signaling in SGC-7901 human gastric cancer cells. Oncol Rep. 2014;31(4):1645–52.View ArticlePubMedGoogle Scholar
  18. Kodigepalli KM, Anur P, Spellman P, et al. Phospholipid scramblase 1, an interferon-regulated gene located at 3q23, is regulated by SnoN/SkiL in ovarian cancer cells. Mol Cancer. 2013;12:32.View ArticlePubMedPubMed CentralGoogle Scholar
  19. Moises T, Wüller S, Saxena S, et al. Proteasomal inhibition alters the trafficking of the neurotrophin receptor TrkA. Biochem Biophys Res Commun. 2009;387(2):360–4.View ArticlePubMedGoogle Scholar
  20. Ora I, Bondesson L, Jönsson C, et al. Arsenic trioxide inhibits neuroblastoma growth in vivo and promotes apoptotic cell death in vitro. Biochem Biophys Res Commun. 2000;277(1):179–85.View ArticlePubMedGoogle Scholar
  21. Mazzocco K, Defferrari R, Sementa AR, et al. Genetic abnormalities in adolescents and young adults with neuroblastoma: a report from the Italian Neuroblastoma group. Pediatr Blood Cancer. 2015;62(10):1725–32.View ArticlePubMedGoogle Scholar
  22. Stasevych M, Zvarych V, Lunin V, et al. Novel anthraquinone-based derivatives as potent inhibitors for receptor tyrosine kinases. Indian J Pharm Sci. 2015;77(5):634–7.View ArticlePubMedPubMed CentralGoogle Scholar
  23. Brodeur GM, Minturn JE, Ho R, et al. Trk receptor expression and inhibition in neuroblastoma. Clin Cancer Res. 2009;15(10):3244–50.View ArticlePubMedPubMed CentralGoogle Scholar
  24. Fung W, Hasan MY, Loh AH, et al. Gene expression of TRK neurotrophin receptors in advanced neuroblastomas in Singapore: a pilot study. Pediatr Hematol Oncol. 2011;28(7):571–8.View ArticlePubMedGoogle Scholar
  25. Thress K, Macintyre T, Wang H, et al. Identification and preclinical characterization of AZ-23, a novel, selective, and orally bioavailable inhibitor of the Trk kinase pathway. Mol Cancer Ther. 2009;8(7):1818–27.View ArticlePubMedGoogle Scholar
  26. Nakamura Y, Suganami A, Fukuda M, et al. Identification of novel candidate compounds targeting TrkB to induce apoptosis in neuroblastoma. Cancer Med. 2014;3(1):25–35.View ArticlePubMedPubMed CentralGoogle Scholar
  27. Werner P, Paluru P, Simpson AM, et al. Mutations in NTRK3 suggest a novel signaling pathway in human congenital heart disease. Hum Mutat. 2014;35(12):1459–68.View ArticlePubMedPubMed CentralGoogle Scholar
  28. Tacconelli A, Farina AR, Cappabianca L, et al. Alternative TrkAIII splicing: a potential regulated tumor-promoting switch and therapeutic target in neuroblastoma. Future Oncol. 2005;1(5):689–98.View ArticlePubMedGoogle Scholar
  29. Jeanne M, Lallemand-Breitenbach V, Ferhi O, et al. PML/RARA oxidation and arsenic binding initiate the antileukemia response of As2O3. Cancer Cell. 2010;18(1):88–98.View ArticlePubMedGoogle Scholar
  30. Jadhav V, Ray P, Sachdeva G, et al. Biocompatible arsenic trioxide nanoparticles induce cell cycle arrest by p21(WAF1/CIP1) expression via epigenetic remodeling in LNCaP and PC3 cell lines. Life Sci. 2016;1(148):41–52.View ArticleGoogle Scholar
  31. Gwak HS, Park MJ, Park IC, et al. Tetraarsenic oxide-induced inhibition of malignant glioma cell invasion in vitro via a decrease in matrix metalloproteinase secretion and protein kinase B phosphorylation. J Neurosurg. 2014;121(6):1483–91.View ArticlePubMedGoogle Scholar
  32. Ma Y, Yan M, Huang H, et al. Associations and prognostic significance of p27Kip1 Jab1 and Skp2 in non-Hodgkin lymphoma. Mol Clin Oncol. 2016;5(4):357–64.View ArticlePubMedPubMed CentralGoogle Scholar
  33. Brodeur GM, Pritchard J, Berthold F, et al. Revisions of the international criteria for neuroblastoma diagnosis, staging, and response to treatment. J Clin Oncol. 1993;11(8):1466–77.View ArticlePubMedGoogle Scholar
  34. Torrealba N, Rodríguez-Berriguete G, Fraile B, et al. Expression of several cytokines in prostate cancer: correlation with clinical variables of patients. Relationship with biochemical progression of the malignance. Cytokine. 2017;89:105–15.View ArticlePubMedGoogle Scholar
  35. Richter M, Dayaram T, Gilmartin AG, et al. WIP1 phosphatase as a potential therapeutic target in neuroblastoma. PLoS ONE. 2015;10(2):e0115635.View ArticlePubMedPubMed CentralGoogle Scholar
  36. Higashi M, Kolla V, Iyer R, et al. Retinoic acid-induced CHD5 upregulation and neuronal differentiation of neuroblastoma. Mol Cancer. 2015;14:150.View ArticlePubMedPubMed CentralGoogle Scholar
  37. Redden RA, Iyer R, Brodeur GM, et al. Rotary bioreactor culture can discern specific behavior phenotypes in Trk-null and Trk-expressing neuroblastoma cell lines. Vitro Cell Dev Biol Anim. 2014;50(3):188–93.View ArticleGoogle Scholar
  38. Hoehner JC, Olsen L, Sandstedt B, et al. Association of neurotrophin receptor expression and differentiation in human neuroblastoma. Am J Pathol. 1995;147(1):102–13.PubMedPubMed CentralGoogle Scholar
  39. Deinhardt K, Chao MV. Trk receptors. Handb Exp Pharmacol. 2014;220:103–19.View ArticlePubMedGoogle Scholar
  40. Kasukabe T, Okabe-Kado J, Kato N, et al. Cotylenin A and arsenic trioxide cooperatively suppress cell proliferation and cell invasion activity in human breast cancer cells. Int J Oncol. 2015;46(2):841–8.View ArticlePubMedGoogle Scholar
  41. Pinski J, Weeraratna A, Uzgare AR, et al. Trk receptor inhibition induces apoptosis of proliferating but not quiescent human osteoblasts. Cancer Res. 2002;62(4):986–9.PubMedGoogle Scholar
  42. Woo SY, Lee MY, Jung YJ, et al. Arsenic trioxide inhibits cell growth in SH-SY5Y and SK-N-AS neuroblastoma cell lines by a different mechanism. Pediatr Hematol Oncol. 2006;23(3):231–43.View ArticlePubMedGoogle Scholar
  43. Park JW, Choi YJ, Jang MA, et al. Arsenic trioxide induces G2/M growth arrest and apoptosis after caspase-3 activation and bcl-2 phosphorylation in promonocytic U937 cells. Biochem Biophys Res Commun. 2001;286(4):726–34.View ArticlePubMedGoogle Scholar
  44. Yu Z, Wang R, Xu L, et al. N-(beta-Elemene-13-yl)tryptophan methyl ester induces apoptosis in human leukemia cells and synergizes with arsenic trioxide through a hydrogen peroxide dependent pathway. Cancer Lett. 2008;269(1):165–73.View ArticlePubMedGoogle Scholar
  45. Liu L, Li Y, Xiong X, et al. Low dose of arsenic trioxide inhibits multidrug resistant-related P-glycoprotein expression in human neuroblastoma cell line. Int J Oncol. 2016;49(6):2319–30.View ArticlePubMedGoogle Scholar
  46. Ling YH, Jiang JD, Holland JF, et al. Arsenic trioxide produces polymerization of microtubules and mitotic arrest before apoptosis in human tumor cell lines. Mol Pharmacol. 2002;62(3):529–38.View ArticlePubMedGoogle Scholar
  47. Panicker J, Li Z, McMahon C, et al. Romidepsin (FK228/depsipeptide) controls growth and induces apoptosis in neuroblastoma tumor cells. Cell Cycle. 2010;9(9):1830–8.View ArticlePubMedGoogle Scholar
  48. Wang L, Gallo KA, Conrad SE. Targeting mixed lineage kinases in ER-positive breast cancer cells leads to G2/M cell cycle arrest and apoptosis. Oncotarget. 2013;4(8):1158–71.View ArticlePubMedPubMed CentralGoogle Scholar
  49. Zheng C, Geetha T, Gearing M, et al. Amyloid β-abrogated TrkA ubiquitination in PC12 cells analogous to Alzheimer’s disease. J Neurochem. 2015;133(6):919–25.View ArticlePubMedGoogle Scholar
  50. Qi D, Ouyang C, Wang Y, et al. HO-1 attenuates hippocampal neurons injury via the activation of BDNF-TrkB-PI3K/Akt signaling pathway in stroke. Brain Res. 2014;1577:69–76.View ArticlePubMedGoogle Scholar
  51. Zhang SW, Liu X, Chan CB, et al. Amitriptyline is a TrkA and TrkB receptor agonist that promotes TrkA/TrkB heterodimerization and has potent neurotrophic activity. Chem Biol. 2009;16(6):644–56.View ArticleGoogle Scholar
  52. Cimmino F, Schulte JH, Zollo M, et al. Galectin-1 is a major effector of TrkB-mediated neuroblastoma aggressiveness. Oncogene. 2009;28(19):2015–23.View ArticlePubMedGoogle Scholar

Copyright

© The Author(s) 2018

Advertisement