Skip to main content

Table 1 Primer sequences and expected PCR product lengths in the multiplex PCR protocol

From: Arsenic trioxide induces cell cycle arrest and affects Trk receptor expression in human neuroblastoma SK-N-SH cells

Gene Size (bp) Upstream primer (5′–3′) Downstream primer (5′–3′)
TrkA 570 TCCAACACGGAGGCAATC CCAGGACATCCAGGTAGACAG
TrkB 472 TCCGAGATTGGAGCCTAACAG CCACCAGGATCAGTTCAGACA
TrkC 628 CAAGCCCACCCACTACAACA GTGGGACTCACTTCGTCAAAC