Skip to content

Advertisement

Biological Research

What do you think about BMC? Take part in

Open Access

The comparative mitogenomics and phylogenetics of the two grouse-grasshoppers (Insecta, Orthoptera, Tetrigoidea)

Biological Research201750:34

https://doi.org/10.1186/s40659-017-0132-9

Received: 1 December 2016

Accepted: 4 September 2017

Published: 5 October 2017

Abstract

Objective

This study aimed to reveal the mitochondrial genomes (mtgenomes) of Tetrix japonica and Alulatettix yunnanensis, and the phylogenetics of Orthoptera species.

Methods

The mtgenomes of A. yunnanensis and T. japonica were firstly sequenced and assembled through partial sequences amplification, and then the genome organization and gene arrangement were analyzed. Based on nucleotide/amino acid sequences of 13 protein-coding genes and whole mtgenomes, phylogenetic trees were established on 37 Orthoptera species and 5 outgroups, respectively.

Results

Except for a regulation region (A+T rich region), a total of 37 genes were found in mtgenomes of T. japonica and A. yunnanensis, including 13 protein-coding genes, 2 ribosomal RNA genes, and 22 transfer RNA genes, which exhibited similar characters with other Orthoptera species. Phylogenetic tree based on 13 concatenated protein-coding nucleotide sequences were considered to be more suitable for phylogenetic reconstruction of Orthoptera species than amino acid sequences and mtgenomes. The phylogenetic relationships of Caelifera species were Acridoidea and Pamphagoidea > Pyrgomorphoidea > Pneumoroidea > Eumastacoidea > Tetrigoidea > Tridactyloidea. Besides, a sister-group relationship between Tettigonioidea and Rhaphidophoroidea was revealed in Ensifera.

Conclusion

Concatenated protein-coding nucleotide sequences of 13 genes were suitable for reconstruction of phylogenetic relationship in orthopteroid species. Tridactyloidea was a sister group of Tetrigoidea in Caelifera, and Rhaphidophoroidea was a sister group of Tettigonioidea in Ensifera.

Keywords

Mitogenome Orthoptera Tetrigoidea Phylogenetic

Introduction

Mitochondrial genome (mtgenome) is a kind of small circular molecule in most of metazoans, which evolves semi-independently from nuclear genomes and plays an important role in the process of metabolism, programmed cell death, illness, and aging. Generally, the closed circular mtDNA was 14–39 kb in length, which consists of a major non-coding region (regulation region, A + T rich region) and a canonical set of 37 genes, including 13 protein-coding genes, 2 ribosomal RNAs (rRNA) and 22 transfer RNAs (tRNA). The distribution of these genes is always compact with infrequent introns and intergenic space [1, 2]. As low frequency of intermolecular genetic recombination and relatively rapid evolutionary rate, mtgenome has been extensively used for researching on population structures, phylogeography and phylogenetic relationships at various taxonomic levels [3, 4].

Recently, mtgenome has been widely used in phylogenetic analyses. It has been reported, mtgenomes could provide rich information’s in phylogenetics [5]. Phylogenetic analyses based on complete mtgenome sequences could improve the statistical confidence of inferred phylogenetic trees with better resolution than analyses only based on partial mtgenes [6]. The evolution of mtgenomes, instead of mtgenes, was a new instrument for studying biological speciation and lineage divergence [7]. In addition, mtgenome may partly represent the whole genome, and be used as a phylogenetic marker in investigation of structural genomic features easily and systematically [8]. All these features of mtgenome greatly promoted the researches on evolutionary trends and relationships of phylogenetically distant organisms [9].

With the growing interest in mtgenomes, a rapid increase of published complete mtgenome sequences was revealed [10]. Despite insects were the most species-rich class animals, the sequenced mtgenomes are majorly vertebrates. Until now, more than 8634 complete metazoan mtgenomes have been sequenced, and only 337 are from insects and 39 are from Orthoptera (http://www.ncbi.nlm.nih.gov). Besides, two mtgenomes of Tetrigoidea were announced by our previous studies [10]. Orthoptera is a kind of primitive hemimetabolous insects, contains approximately 20,000 described species in two suborders of equal size (Caelifera and Ensifera) [11]. A preliminary phylogenetic analyses of Orthoptera based on the mtgenome data have been performed, while the superfamily Tetrigoidea was not involved. Tetrigoidea is a moderately diverse group of basal Caelifera comprising approximately 1400 species in 8 families and 270 genera [12]. As a monophyletic group supported by molecular data, Tetrigoidea was regarded as one of the oldest groups in Caelifera, which closely related to Tridactyloidea [13, 14]. Researches on the mtgenome sequences of Tetrigoidea may contribute to the revelation of phylogenetic relationships in Orthoptera. In this study, the mtgenomes of two Tetrigoidea species, A. yunnanensis and T. japonica were firstly revealed, and the genome organization and gene arrangement were then analyzed. Meanwhile, phylogenetic trees were established to evaluate the phylogenetics of Orthoptera species. Our findings may enrich our knowledge on mtgenomes of Tetrigoidea, and provide an efficient strategy for biodiversity exploring on Orthoptera species.

Materials and methods

Samples and DNA extraction

Specimens of A. yunnanensis and T. japonica were collected from a public land (not a protected area or a national park) in Nanjing, Jiangsu, China. Total genomic DNA was extracted from the femoral muscle of fresh specimens by the standard proteinase K and phenol/chloroform extraction method. Simply, the tissues were firstly disintegrated with 20 mg/ml proteinase K (Genebase Gene-Tech Co., Ltd) at 37 °C for 2–3 h. Then, the samples were incubated with extraction solution, and V/2 of phenol and V/2 of chloroform was added. After centrifugation, the supernatant was obtained, and 1/10 volume of 3 M NaOAc and 2 volumes of 100% ethanol were used to precipitate the DNA. Finally, the precipitate (DNA) was dissolved in Tris–EDTA buffer solution, and quantified with spectrafluorometer. The isolated DNA samples were stored at −20 °C and used as a template for subsequence PCR reactions.

Primer design and PCR amplification

Some partial sequences were firstly amplified and sequenced using general primers based on Simon et al. [15]. Then, new primers were designed based on determined sequences, and each amplified segments could overlap the adjacent segments (Primers were shown in Table 1). The fragments of mtgenomes were amplified by PCR using Takara LA Taq™ (Takara Bio, Otsu, Shiga, Japan). The PCR program included an initial denaturation at 94 °C for 3 min, followed by 10 cycles of denaturation at 94 °C for 30 s, annealing at 52–59 °C to 0.3 °C/cycle (depending on primer combinations) for 30 s, elongation at 68 °C for 60–180 s (depending on putative length of the fragments); then followed by another PCR program included 20 cycle of 30 s denaturation at 94 °C, 30 s annealing at 49–56 °C, 60–180 s elongation at 68 °C and a final extension at 68 °C for 8 min. The PCR products were identified by electrophoresis on 1% agarose gel.
Table 1

Sequencing primers used in the analysis of mitochondrial genome of Alulatettix yunnanensis and Tetrix japonica

Upstream primers sequences (5′–3′)

Downstream primers sequences (5′–3′)

Anneal temperature (°C)

190-J:

AAGCTAMTGGGTTCATRCCC

1650-F:

AAYCAATTTCCGAATCCACC

53

1600-J:

GTTGTTGTAACAGCACATGC

2750-F:

CCTCCTATAATAGCAAATACTGCTCC

54

2650-J:

TTACCTGTTYTWGCWGGAGC

3660-F:

CCACAAATTTCAGAGCATTGACC

55

3600-J:

CAATGATACTGATCATATGAATATTC

4900-F:

ATCYCGTCATCATTGAATTAT

53

4800-J:

TAGTAGACTATAGTCCATGACC

6150-F:

CCATTCTTTCAGGTCGAAACTG

55

5800-J:

GAGCAWCTTAGGGTTATAGTT

7600-F:

TAAGWAATCGKRTWGGTGATGT

52

7500-J:

CAGGAGTAGGAGCAGCTATAGC

8650-F:

CTTGTAATATATCGGCTCCTCC

56

8500-J:

GTGTAATAAGAATAACTAATTAAGCC

9000-F:

TGTTGCAGCTTCATTACCATTATTGT

49

8900-J:

GGGGCCTCAACATGAGCYTT

10600-F:

TTTCATCATATTGAAATRTTTRTTGG

51

10300-J:

CAACAATAATGAAACAAYRAATATAG

11600-F:

AAATAYCATTCTGGTTGAATGTG

51

11450-J:

CCCATATATTATAGGAGAYCC

12300-F:

TATGAGTTCGGGGTACTTTACC

53

12050-J:

AAAAACCCCCTTCAAGCCAAAT

13350-F:

GACYGTRCAAAGGTAGCATAATC

54

13150-J:

TTCTCGTTAAACCTTTCATTCCAGT

14300-F:

TATTTCAGGTCAAGGTGCAGCTTAT

54

14100-J:

CTACTWTGTTACGACTTATCTC

14450-F:

ARACTAGGATTAGATACCCT

51

14330-J:

TAACATCATTCATGAAACAGGTTCCTCT

250-F:

ATTTCTAGTCCTATTCACACACCTAATC

54

Sequencing and sequence assembly

The PCR products with single band were purified using a V-gen PCR clean-up purification kit. If more than one band was present, the appropriately sized PCR product was cut off from the gel and purified using a biospin gel extraction kit. All fragments were sequenced in both directions, and some PCR products were sequenced by primer walking strategy. The identified sequences were assembled by seqman (DNASTAR 2001), BioEdit and Chromas 2.22, and then the complete mtgenome sequences of T. japonica and A. yunnanensis were manually checked. The coverage of each mtgenome was above two times.

Sequence analysis

Gene encoding proteins, rRNA and tRNA were identified according to their amino acid translation or secondary structure features, respectively. Individual gene sequences were compared with the available homologous sequences of Orthoptera species in GenBank. A total of 22 tRNA genes were identified using software tRNA Scan-SE 1.21 (http://lowelab.ucsc.edu/tRNAscan-SE) and their cloverleaf secondary structures and anticodon sequences were identified using DNASIS (Ver.2.5, Hitachi Software Engineering).

The reconstruction of phylogenetic trees

In order to evaluate the phylogenetic relationships in Orthoptera, phylogenetic trees were established based on nucleotide/amino acid sequences of 13 protein-coding genes and whole mtgenome sequences of 37 Orthoptera species whose complete mtgenome sequences were available in GenBank by using two Blattaria species (Periplaneta fuliginosa and Eupolyphaga sinensis), two Isoptera specie (Reticulitermes flavipes and Coptotermes formosanus) and one Mantodea specie (Tamolanica tamolana) as outgroup [6]. Mtgenome sequences were downloaded from GenBank (Table 2).
Table 2

A total of 37 Orthoptera species were used in reconstruction of phylogenetic trees. Two Blattaria species, two Isoptera specie and one Mantodea specie were considered as outgroup

Taxa

Species

Accession

Caelifera/Tetrigoidea

Tetrix japonica

 

Alulatettixyunnanensis

JQ272702

Caelifera/Acridoidea

Acridacinerea

GU344100

Acridawillemsei

EU938372

Arcypteracoreana

GU324311

Chorthippuschinensis

EU029161

Euchorthippusfusigeniculatus

HM583652

Gastrimargusmarmoratus

EU513373

Gomphocerussibiricustibetanus

HM131804

Gomphoceruslicenti

GQ180102

Locustamigratoriatibetensis

HM219224

Locustamigratoria

X80245

Oedaleusdecorusasiaticus

EU513374

Ognevialongipennis

EU914848

Oxyachinensis

EF437157

Phlaeobaalbonema

EU370925

Prumnaarctica

GU294758

Schistocercagregariagregaria

GQ491031

Trauliaszetschuanensis

EU914849

Xyleusmodestus

GU945503

Caelifera/Eumastacoidea

Pielomastaxzhengi

JF411955

Caelifera/Pamphagoidea

Thrinchusschrenkii

GU181288

Caelifera/Pneumoroidea

Physemacrisvariolosa

GU945504

Caelifera/Pyrgomorphoidea

Atractomorphasinensis

EU263919

Mekongiellaxizangensis

HM583654

Mekongianaxiangchengensis

HM583653

Caelifera/Tridactyloidea

Ellipesminuta

GU945502

Ensifera/Tettigonioidea

Anabrus simplex

EF373911

Deracanthaonos

EU137664

Elimaeacheni

GU323362

Gampsocleisgratiosa

EU527333

Ruspoliadubia

EF583824

Ensifera/Grylloidea

Gryllotalpaorientalis

AY660929

Gryllotalpapluvialis

EU938371

Myrmecophilusmanni

EU938370

Teleogryllusemma

EU557269

Ensifera/Rhaphidophoroidea

Troglophilusneglectus

EU938374

Blattaria

Periplanetafuliginosa

AB126004

Eupolyphagasinensis

FJ830540

Isoptera

Reticulitermesflavipes

EF206314

Coptotermesformosanus

AB626145

Mantodea

Tamolanicatamolana

DQ241797

Alignments and bayesian analyses

The nucleotide and amino acid sequences were aligned by ClusterW in MEGA 4.0 with manual refinements [16]. One alignment was based on the complete mtDNA sequences, except for the highly variable ETAS (extended termination associated sequence) domain within regulation region, creating a sequence of 15,612 nt positions. The second alignment was based on the complete set of codons (except stop codons) creating a concatenated sequence of 10,989 nt positions (3663 amino acid positions) corresponding to the 13 protein-coding genes.

Bayesian analyses were performed by MRBAYES 3.1.2, with gaps treated as missing data [10]. The best fitting substitution model judged by Akaike information criterion (AIC) was determined by MrMODELTEST 2.3 [17]. For each BI analysis, two independent sets of monte carlo markov chains (MCMC) were run, each with one cold and three heated chains for 1 × 106 generations, and every 1000 generations were sampled. The burn-in parameter was estimated by plotting-lnL against the generation number using TRACER v1.4.1, and the retained trees were used to estimate the consensus tree and Bayesian posterior probabilities [18].

Results

Genome organization and gene arrangement

By sequencing and sequence assembly, a total of 37 genes were found in mtgenomes of T. japonica and A. yunnanensis, including 13 protein-coding genes (nad2, COI, COII, atp8, atp6, COIII, nad3, nad5, nad4, nad4L, nad6, cob and nad1), 2 rRNA (12S rRNA and 16S rRNA), and 22 tRNA. Meanwhile, a regulation region (A+T rich region) was also found in the mtgenomes (Table 3).
Table 3

Annotation of the mitochondrial genomes in Tetrix japonica (Tj) and Alulatettix yunnanensis (Ay)

Feature

Strand

Position

Initiation codon/Stop codon

Anticodon

Tj

Ay

Tj

Ay

trnI

J

1–64

1–65

  

GAT

trnQ

N

65–133

66–134

  

TTG

trnM

J

134–201

135–202

  

CAT

nad2

J

201–1202

203–1204

ATG/TAA

ATG/TAA

 

trnW

J

1201–1266

1203–1268

  

TCA

trnC

N

1259–1324

1261–1326

  

GCA

trnY

N

1325–1388

1327–1390

  

GTA

COI

J

1386–2924

1388–2926

ATC/TAA

ATC/TAA

 

trnL(UUR)

J

2920–2983

2922–2985

  

TAA

COII

J

2984–3667

2986–3669

ATG/TAA

ATG/TAA

 

trnD

J

3666–3729

3668–3729

  

CTT

trnK

J

3730–3797

3730–3797

  

GTC

atp8

J

3802–3957

3802–3957

ATG/TAA

ATG/TAA

 

atp6

J

3951–4622

3951–4622

ATG/TAA

ATG/TAA

 

COIII

J

4625–5428

4625–5428

ATA/TAA

ATA/TAA

 

trnG

J

5412–5474

5412–5474

  

TCC

nad3

J

5472–5828

5472–5828

ATA/TAG

ATA/TAG

 

trnA

J

5827–5891

5827–5891

  

TGC

trnR

J

5891–5953

5891–5953

  

TCG

trnN

J

5950–6013

5950–6013

  

GTT

trnS

J

6013–6081

6013–6081

  

GCT

trnE

J

6081–6144

6081–6144

  

TTC

trnF

N

6143–6205

6143–6205

  

GAA

nad5

N

6207–7922

6206–7925

ATG/TAA

ATG/T–

 

trnH

N

7926–7989

7929–7992

  

GTG

nad4

N

7989–9314

7992–9317

ATG/TAG

ATG/TAG

 

nad4L

N

9308–9598

9311–9601

ATT/TAA

ATT/TAA

 

trnT

J

9601–9666

9604–9668

  

TGT

trnP

N

9667–9730

9669–9732

  

TGG

nad6

J

9732–10,226

9734–10,228

ATG/TAA

ATG/TAA

 

cob

J

10,226–11,362

10,228–11,364

ATG/TAG

ATG/TAG

 

trnS(UCN)

J

11,361–11,428

11,363–11,430

  

TGA

nad1

N

11,441–12,385

11,443–12,387

ATA/TAA

ATA/TAA

 

trnL

N

12,380–12,442

12,382–12,444

  

TAG

16S

N

12,443–13,739

12,445–13,784

   

trnV

N

13,741–13,811

13,786–13,857

  

TAC

12S

N

13,812–14,597

13,858–14,644

   

A+Trich

 

14,598–15,128

14,645–15,104

   

J represents sense strand, N represents antisense strand

The arrangement of mtgenome was very compact in these two species, which exhibited many gene overlaps. In T. japonica, 21 gene overlaps in 1–17 bp with a total of 77 bp in length were found. Similarly, 19 gene overlaps in 1–17 bp with a total of 75 bp in length were found in A. yunnanensis. In addition, 8 non-coding regions in 1–12 bp with a total of 26 bp in length, and 7 non-coding regions in 1–12 bp with a total of 25 bp in length were revealed in A+T-rich regions of T. japonica and A. yunnanensis, respectively. Besides, 22 tRNA genes were also found in mtgenomes of T. japonica and A. yunnanensis, which exhibited a same relative genomic position in other Orthoptera insects. The predicated secondary structures of these 22 tRNA genes in T. japonica and A. yunnanensis were shown in Additional file 1: Figure S1 and Additional file 2: Figure S2.

The nucleotide composition of these two mitogenomes (T. japonica and A. yunnanensis) biased toward adenine and thymine (75.57% in T. japonica and 75.24% in A. yunnanensis). ATN was the preferred initiation codon of 13 protein-coding genes in T. japonica and A. yunnanensis, including 8 ATG, 3 ATA, 1 ATC and 1 ATT. TAA and TAG were considered to be the termination codons of these 13 protein-coding genes in T. japonica and A. yunnanensis, except one T of nad5 gene in A. yunnanensis (Table 3). Besides, the A+T-rich regions of the two mtgenomes were also located between small rRNA and tRNA Ile , which were 531 bp with 82.67% A+T and 460 bp with 80.87% A+T in T. japonica and A. yunnanensis, respectively. Short repeating sequences except Poly A and Poly T could not be found throughout the whole A+T-rich regions.

Phylogenetic analyses

Based on 13 concatenated protein-coding nucleotide sequences, the topology of established phylogenetic tree was similar with the reconstructed tree based on the whole mtgenome sequences. Differently, Teleogryllus emma of Gryllidae was revealed to be basal to all other Orthoptera species in phylogenetic tree of protein-coding nucleotide sequences, which was conflicted with the monophyletic Gryllidae in phylogenetic tree of mtgenome (Fig. 1a, c). In phylogenetic tree based on amino acid, Thrinchus schrenkii was found to belong to Pamphagoidea among various species of Acridoidea, which was also not consistent with the monophyletism of Acridoidea (Fig. 1b). According to the 37 Orthoptera species, 13 concatenated protein-coding DNA sequences were suspected to be accurate and effective for phylogenetic reconstruction of Orthoptera species.
Fig. 1

Phylogenetic tree established by concatenated protein-coding DNA sequences (N = 13) a, concatenated amino acids b, and whole mtgenome sequences c of 37 Orthopteran species and 5 outgroups (two Blattaria species, two Isoptera specie and one Mantodea specie). The red underline is the species position of Alulatettix yunnanensis and Tetrix japonica

As shown in Fig. 1a, two Orthopteran suborders, Caelifera and Ensifera were both recovered as monophyletic groups. In Caelifera branch, Acridoidea, Pyrgomorphoidea and Tetrigoidea were monophyletic groups. The phylogenetic relationships of these superfamilies were Acridoidea and Pamphagoidea > Pyrgomorphoidea > Pneumoroidea > Eumastacoidea > Tetrigoidea > Tridactyloidea. In Ensifera, a sister-group relationship between Tettigonioidea and Rhaphidophoroidea was revealed.

Discussion

According to our previous studies, the mtgenomes of T. japonica (15,128 bp) and A. yunnanensis (15,104 bp) were circular molecules (GenBank accession numbers: JQ340002 and JQ272702) [19, 20]. In this study, a total of 37 typical genes and a regulation region were found in the mtgenomes of T. japonica and A. yunnanensis, which exhibited similar gene order and orientation with other Orthopteran insects. The conserved mtgenome structure in divergent insects identified their close genetic relationships [10]. In addition, the main nucleotide composition of these two mtgenomes was revealed to be adenine and thymine (75.57% of T. japonica and 75.24% of A. yunnanensis). Although the nucleotide composition was slightly lower than that found in some other Orthoptera insects (Locusta migratoria 75.3%, Oxya chinensis 75.9% and Acrida willemsei 76.2%), it was still corresponded well to the normal range of insect mtgenomes from 69.2% to 84.9% [10]. These data should be useful for developing mtgenome genetic markers for species identification of Orthoptera insects.

In mtgenomes of T. japonica and A. yunnanensis, 22 tRNA genes were identified in the same relative genomic positions as observed in other Orthoptera insects. The typical cloverleaf secondary structures and anticodons of these tRNAs were also similar to those found in other metazoan animals. As the only major non-coding region in insect mtgenome, the regulation region (A+T rich region) biased on A+T nucleotides were evolved under a strong directional mutation pressure [21]. It has been reported the A+T rich region was varied greatly in insects, from 70 bp in Ruspolia dubia to 4601 bp in Drosophila melanogaster [22, 23]. In this study, A+T rich regions in 531 bp length with 82.67% A+T and 460 bp length with 80.87% A+T located between small rRNA and tRNA Ile were revealed in T. japonica and A. yunnanensis, respectively. This region may limit its use for both inter- and intra-specific analyses in evolutionary studies.

In phylogenetic analyses, a similar topology of the established phylogenetic trees based on the whole mtgenome sequences and concatenated protein-coding nucleotide sequences were revealed. However, Teleogryllus emma of Gryllidae basal to all other Orthoptera species based on nucleotide sequences was conflict with the monophyletic Gryllidae based on mtgenome sequences. This phenomenon may be explained by that the mitochondrial non-protein-coding sequences of Orthoptera species, such as tRNA genes with nucleotide conservation were different from protein-coding sequences with relatively fast evolutionary rate, thereby disturbing phylogenetic reconstruction [24]. In addition, the phylogenetic tree based on amino acid showed that Thrinchus schrenkii of Pamphagoidea was nested within Acridoidea, which was conflicted with the monophyletism of Acridoidea. As amino acid sequences were usually conserved due to invisible synonymous substitutions in amino acid level, nucleotide sequences may be more reliable for phylogenetic reconstruction of closely related Acridoidea species [25]. These results of phylogenetic trees in 37 Orthopteran species indicated that the best way for phylogenetic reconstruction of Orthoptera was based on the concatenated protein-coding nucleotide sequences, but not the amino acid sequences and entire mtgenomes. As shown in phylogenetic trees based on concatenated protein-coding nucleotide sequences, two Orthopteran suborders, Caelifera and Ensifera, were both recovered as monophyletic groups, which were consisted with previous studies of morphological and molecular data [5]. The phylogenetic relationships of the superfamilies in Caelifera also supported previous results of Flook and Rowell [13]. Besides, a sister group relationship between Tettigonioidea and Rhaphidophoroidea was revealed in Ensifera, which was also consist with the results presented by Fenn et al. [5] and Zhou et al. [26]. The assumption that Gryllidae was basal to all other Ensifera received strong supports.

In conclusion, T. japonica and A. yunnanensis, together with other Orthoptera species, exhibited the same mitochondrial genome organization. The concatenated nucleotide sequences of 13 protein genes were suitable markers for reconstruction of phylogenetic relationship in orthopteroid species. The relationships of Tridactyloidea as sister group of Tetrigoidea in Caelifera and Rhaphidophoroidea as sister group of Tettigonioidea in Ensifera were identified. However, this study was still limited by insufficient species, and their phylogenetic relationships were not accurately identified. Further researches on mtgenome data and morphological characters were still needed to reveal the relationships of Orthoptera species.

Declarations

Authors’ contributions

YS and DL carried out the molecular genetic studies, participated in the sequence alignment and drafted the manuscript. YS and DL carried out the immunoassays. YS and BX participated in the sequence alignment. DL and GJ participated in the design of the study and performed the statistical analysis. BX and GJ conceived of the study, and participated in its design and coordination and helped to draft the manuscript. All authors read and approved the final manuscript.

Acknowledgements

None.

Competing interests

The authors declare that they have no competing interests.

Availability of data and materials

All data generated or analysed during this study are included in this published article.

Consent for publication

Not applicable.

Ethics approval and consent to participate

Not applicable.

Funding

This work was jointly supported by the National (Youth) Natural Science Foundation of China (Grant Nos. 41302272; 31572246) and the Youth Natural Science Foundation of Jiangsu Province (No. BK20140330).

Publisher’s Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Open AccessThis article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated.

Authors’ Affiliations

(1)
Key Laboratory for Ecology and Pollution Control of Coastal Wetlands, School of Environmental Science and Engineering, Yancheng Institute of Technology
(2)
School of Biology and Basic Medical Sciences, Medical College, Soochow University
(3)
College of Oceanology and Food Science, Quanzhou Normal University
(4)
Department of Bioengineering and Food Engineering, Puyang Vocational & Technical Institute

References

  1. Breton S, Milani L, Ghiselli F, Guerra D, Stewart DT, Passamonti M. A resourceful genome: updating the functional repertoire and evolutionary role of animal mitochondrial DNAs. Trends Genet. 2014;30(12):555–64.View ArticlePubMedGoogle Scholar
  2. Boore JL. Animal mitochondrial genomes. Nucleic Acids Res. 1999;27(8):1767–80.View ArticlePubMedPubMed CentralGoogle Scholar
  3. Fernandes-Matioli FM, Almeida-Toledo LF. A molecular phylogenetic analysis in Gymnotus species (Pisces: Gymnotiformes) with inferences on chromosome evolution. Caryologia. 2001;54(1):23–30.View ArticleGoogle Scholar
  4. Moore WS. Mitochondrial-gene trees versus nuclear-gene trees, a reply to Hoelzer. Evolution. 1997;51(2):627–9.View ArticlePubMedGoogle Scholar
  5. Fenn JD, Song H, Cameron SL, Whiting MF. A preliminary mitochondrial genome phylogeny of Orthoptera (Insecta) and approaches to maximizing phylogenetic signal found within mitochondrial genome data. Mol Phylogenet Evol. 2008;49(1):59–68.View ArticlePubMedGoogle Scholar
  6. Hong MY, Jeong HC, Kim MJ, Jeong HU, Lee SH, Kim I. Complete mitogenome sequence of the jewel beetle, Chrysochroa fulgidissima (Coleoptera: Buprestidae). Mitochondrial DNA. 2009;20:46–60.View ArticlePubMedGoogle Scholar
  7. Ravin N, Galachyants Y, Mardanov A, Beletsky A, Petrova D, Sherbakova T, Zakharova Y, Likhoshway Y, Skryabin K, Grachev M. Complete sequence of the mitochondrial genome of a diatom alga Synedra acus and comparative analysis of diatom mitochondrial genomes. Curr Genet. 2010;56(3):215–23.View ArticlePubMedGoogle Scholar
  8. Xiao B, Chen A-H, Zhang Y-Y, Jiang G-F, Hu C-C, Zhu C-D. Complete mitochondrial genomes of two cockroaches, Blattella germanica and Periplaneta americana, and the phylogenetic position of termites. Curr Genet. 2012;58(2):65–77.View ArticlePubMedGoogle Scholar
  9. Gissi C, Iannelli F, Pesole G. Evolution of the mitochondrial genome of Metazoa as exemplified by comparison of congeneric species. Heredity. 2008;101(4):301–20.View ArticlePubMedGoogle Scholar
  10. Xiao B, Chen A-H, Zhang Y-Y, Jiang G-F, Hu C-C, Zhu C-D. Complete mitochondrial genomes of two cockroaches, Blattella germanica and Periplaneta americana, and the phylogenetic position of termites. Curr Genet. 2012;58(2):65–77.View ArticlePubMedGoogle Scholar
  11. Jost MC, Shaw KL. Phylogeny of Ensifera (Hexapoda: Orthoptera) using three ribosomal loci, with implications for the evolution of acoustic communication. Mol Phylogenet Evol. 2006;38(2):510–30.View ArticlePubMedGoogle Scholar
  12. Heads SW. New pygmy grasshoppers in miocene amber from the dominican republic (Orthoptera: Tetrigidae). Denisia. 2009;26:69–74.Google Scholar
  13. Flook PK, Rowell CHF. The phylogeny of the Caelifera (Insecta, Orthoptera) as deduced from mtrRNA Gene Sequences. Mol Phylogenet Evol. 1997;8(1):89–103.View ArticlePubMedGoogle Scholar
  14. Flook PK, Rowell CHF. Inferences about orthopteroid phylogeny and molecular evolution from small subunit nuclear ribosomal DNA sequences. Insect Mol Biol. 1998;7(2):163–78.View ArticlePubMedGoogle Scholar
  15. Simon C, Frati F, Beckenbach A, Crespi B, Liu H, Rook P. Evolution, weighting, and phylogenetic utility of mitochondrial gene sequences and a compilation of conserved polymerase chain reaction primers. Ann Entomol Soc A. 1994;87:1–51.View ArticleGoogle Scholar
  16. Tamura K, Dudley J, Nei M, Kumar S. MEGA4: molecular evolutionary genetics analysis (mega) software version 4.0. Mole Biol Evol. 2007;24(8):1596–9.View ArticleGoogle Scholar
  17. Nylander JAA. MrModeltest v2. Program distributed by the author. Evolutionary Biology Centre, Uppsala University. 2004.Google Scholar
  18. Rambaut A, Drummond AJ. Tracer v1.4: MCMC trace analyses tool. Available from http://www.beastbioedacuk/Tracer. 2007.
  19. Xiao B, Chen W, Hu C-C, Jiang G-F. Complete mitochondrial genome of the groundhopper Alulatettix yunnanensis (Insecta: Orthoptera: Tetrigoidea). Mitochondrial DNA. 2012;23(4):286–7.View ArticlePubMedGoogle Scholar
  20. Xiao B, Feng X, Miao W-J, Jiang G-F. The complete mitochondrial genome of grouse locust Tetrix japonica (Insecta: Orthoptera: Tetrigoidea). Mitochondrial DNA. 2012;23(4):288–9.View ArticlePubMedGoogle Scholar
  21. Zhang DX, Hewitt GM. Insect mitochondrial control region: a review of its structure, evolution and usefulness in evolutionary studies. Biochem Systematics Ecol. 1997;25:99–120.View ArticleGoogle Scholar
  22. Garesse R. Drosophila melanogaster mitochondrial DNA: gene organisation and evolutionary consideration. Genetics. 1988;118:649–63.PubMedPubMed CentralGoogle Scholar
  23. Zhou Z, Huang Y, Shi F. The mitochondrial genome of Ruspolia dubia (Orthoptera: Conocephalidae) contains a short A + T-rich region of 70 bp in length. Genome. 2007;50:855–66.View ArticlePubMedGoogle Scholar
  24. Zhang H-L, Zeng H-H, Huang Y, Zheng Z-M. The complete mitochondrial genomes of three grasshoppers, Asiotmethis zacharjini, Filchnerella helanshanensis and Pseudotmethis rubimarginis (Orthoptera: Pamphagidae). Gene. 2013;517(1):89–98.View ArticlePubMedGoogle Scholar
  25. Goldman N, Yang Z. A codon-based model of nucleotide substitution for protein-coding DNA sequences. Mol Biol Evol. 1994;11(5):725–36.PubMedGoogle Scholar
  26. Zhou X, Xu S, Zhang PAN, Yang G. Developing a series of conservative anchor markers and their application to phylogenomics of Laurasiatherian mammals. Mol Ecol Res. 2011;11(1):134–40.View ArticleGoogle Scholar

Copyright

© The Author(s) 2017

Advertisement