Skip to main content

Table 1 Sequencing primers used in the analysis of mitochondrial genome of Alulatettix yunnanensis and Tetrix japonica

From: The comparative mitogenomics and phylogenetics of the two grouse-grasshoppers (Insecta, Orthoptera, Tetrigoidea)

Upstream primers sequences (5′–3′) Downstream primers sequences (5′–3′) Anneal temperature (°C)
190-J:
AAGCTAMTGGGTTCATRCCC
1650-F:
AAYCAATTTCCGAATCCACC
53
1600-J:
GTTGTTGTAACAGCACATGC
2750-F:
CCTCCTATAATAGCAAATACTGCTCC
54
2650-J:
TTACCTGTTYTWGCWGGAGC
3660-F:
CCACAAATTTCAGAGCATTGACC
55
3600-J:
CAATGATACTGATCATATGAATATTC
4900-F:
ATCYCGTCATCATTGAATTAT
53
4800-J:
TAGTAGACTATAGTCCATGACC
6150-F:
CCATTCTTTCAGGTCGAAACTG
55
5800-J:
GAGCAWCTTAGGGTTATAGTT
7600-F:
TAAGWAATCGKRTWGGTGATGT
52
7500-J:
CAGGAGTAGGAGCAGCTATAGC
8650-F:
CTTGTAATATATCGGCTCCTCC
56
8500-J:
GTGTAATAAGAATAACTAATTAAGCC
9000-F:
TGTTGCAGCTTCATTACCATTATTGT
49
8900-J:
GGGGCCTCAACATGAGCYTT
10600-F:
TTTCATCATATTGAAATRTTTRTTGG
51
10300-J:
CAACAATAATGAAACAAYRAATATAG
11600-F:
AAATAYCATTCTGGTTGAATGTG
51
11450-J:
CCCATATATTATAGGAGAYCC
12300-F:
TATGAGTTCGGGGTACTTTACC
53
12050-J:
AAAAACCCCCTTCAAGCCAAAT
13350-F:
GACYGTRCAAAGGTAGCATAATC
54
13150-J:
TTCTCGTTAAACCTTTCATTCCAGT
14300-F:
TATTTCAGGTCAAGGTGCAGCTTAT
54
14100-J:
CTACTWTGTTACGACTTATCTC
14450-F:
ARACTAGGATTAGATACCCT
51
14330-J:
TAACATCATTCATGAAACAGGTTCCTCT
250-F:
ATTTCTAGTCCTATTCACACACCTAATC
54
\