Skip to main content
Download PDF
  • Research article
  • Open access
  • Published:

A low-protein diet during pregnancy prevents modifications in intercellular communication proteins in rat islets

Biological Research volume 48, Article number: 3 (2015) Cite this article

Abstract

Background

Gap junctions between β-cells participate in the precise regulation of insulin secretion. Adherens junctions and their associated proteins are required for the formation, function and structural maintenance of gap junctions. Increases in the number of the gap junctions between β-cells and enhanced glucose-stimulated insulin secretion are observed during pregnancy. In contrast, protein restriction produces structural and functional alterations that result in poor insulin secretion in response to glucose. We investigated whether protein restriction during pregnancy affects the expression of mRNA and proteins involved in gap and adherens junctions in pancreatic islets. An isoenergetic low-protein diet (6% protein) was fed to non-pregnant or pregnant rats from day 1–15 of pregnancy, and rats fed an isocaloric normal-protein diet (17% protein) were used as controls.

Results

The low-protein diet reduced the levels of connexin 36 and β-catenin protein in pancreatic islets. In rats fed the control diet, pregnancy increased the levels of phospho-[Ser279/282]-connexin 43, and it decreased the levels of connexin 36, β-catenin and beta-actin mRNA as well as the levels of connexin 36 and β-catenin protein in islets. The low-protein diet during pregnancy did not alter these mRNA and protein levels, but avoided the increase of levels of phospho-[Ser279/282]-connexin 43 in islets. Insulin secretion in response to 8.3 mmol/L glucose was higher in pregnant rats than in non-pregnant rats, independently of the nutritional status.

Conclusion

Short-term protein restriction during pregnancy prevented the Cx43 phosphorylation, but this event did not interfer in the insulin secretion.

Background

Pregnancy and a low-protein diet have opposing effects on insulin secretion. Pregnancy increases glucose-stimulated insulin secretion and reduces the threshold for stimulation of insulin secretion by glucose [1, 2]. This effect is attributed to enhanced glucose metabolism, increased activity of the cAMP and PLC pathways [1, 3–5], high β-cell proliferation and increased islet volume [6], insulin synthesis [7] and gap junction coupling among β-cells [8]. In contrast, a low-protein diet reduces insulin secretion in response to glucose as a result of structural and functional alterations, including the reduced size and/or volume of β-cells [9], a decreased level of coupling among β-cells possibly due to the low expression of connexin 36 [10], inappropriate glucose metabolism [11], diminished calcium handling [12] and alterations in the PLC (phospholipase C), PK (protein kinase) C and cAMP/PK (protein kinase) A pathways [13, 14]. The inability of pancreatic islets to increase insulin secretion to a sufficient level to compensate for insulin resistance during pregnancy due to protein restriction could contribute the development of gestational diabetes.

A large body of evidence has indicated that β-cell gap junctions are required for precise regulation of the biosynthesis, storage and release of insulin, particularly in response to glucose stimulation [15–18]. Connexin proteins form membrane channels at gap junctions, allowing β-cells to rapidly exchange cytoplasmic ions and metabolites, signaling the activity state of neighboring cells. This direct communication allows for a coordinated and synchronized response of the islet cell [16, 18–20]. The transcripts of at least three connexin isoforms (Cx36, Cx43, Cx45) have been repeatedly observed in extracts of intact pancreatic islets [21, 22] and purified β-cell preparations derived from these extracts [22, 23]. Immunolabeling studies have confirmed the expression of the Cx36 protein in the insulin-producing β-cells [16, 17, 22]. The pancreatic localization of the Cx43 protein has not been confirmed. However, an increase in Cx43 expression has been observed in rat neonatal islets exposed to prolactin, which promotes the secretory maturation of β-cells [21]. Evidence indicates that Cx43 can modulate cellular proliferation in a manner that is independent of gap junctional communication [24]. Both homozygous and heterozygous transgenic mice that overexpresses Cx43 present increases in the islet size, and heterozygous mice exhibit an increase in insulin levels [25].

Several studies have demonstrated the crucial role of the adherens junction and their associated proteins for the formation, function and structural maintenance of gap junctions [26, 27]. In vitro experiments have demonstrated a correlation between the expression of adhesion molecules, such as E-cadherin, and glucose-stimulated insulin secretion in the MIN6 β-cell lineage and sorted β-cell subpopulations [28–31]. β-catenin is an adherens junction-associated protein that links the cytoplasmic cadherin tail with the cytoskeleton (actin filament) and contributes to the function of cell adhesions [32–34]. A restriction in the level of maternal protein during pregnancy reduced β-catenin expression in placental vessels [35].

Decreased expression of Cx36 in β-cells is associated with increased [36–38] or reduced [39] basal insulin secretion, unaltered [36] or decreased [37] insulin secretion in response to high glucose concentrations, with impaired [39] or preserved [37] glucose homeostasis.

Interestingly, we previously verified [40] that islets from rats submitted to protein restriction during pregnancy exhibit an “inverted U-shape” dose–response curve, with elevated basal insulin secretion, a maximal insulin secretion in response to 8.3 mmol/L glucose, and blunted insulin secretion in response to 11.1 and 16.7 mmol/L glucose. It is reasonable to suppose that this secretory profile could, at least in part, to result from alterations in the expression of gap and adherens junction-associated proteins. Because the regulation of gap junction communication can occur at both the transcriptional and translational levels, we investigated the effect of protein restriction during pregnancy on the gene and protein expression of gap and adherens junction-associated proteins (Cx36, Cx43, β-catenin and β-actin) in pancreatic islets. This study is the first to describe the expression of these genes and proteins in islets from pregnant rats subjected to a low-protein diet. Evaluate the effect of protein restriction on molecular and cellular mechanisms involved in the β-cell adaptation during pregnancy could contribute to identify possibles cause of gestational diabetes and its prevention.

Results

The low-protein non-pregnant (LPNP) group showed a higher food intake than the control non-pregnant (CN) group. Pregnancy enhanced the food intake in the two nutritional status groups, and the low-protein pregnant (LPP) group ate the same amount of food as the control pregnant (CP) group. Independently of nutritional status, pregnant rats had a greater body weight gain and a higher final body weight (F1,66 = 532.97, P < 0.0001 and F1,66 = 41.36, P < 0.0001, respectively), and they had a lower serum glucose concentration (F1, 23 = 5.80, P < 0.05) than the non-pregnant rats. The serum insulin concentration and the insulin:glucose ratio did not differ among the groups (Table 1).

Table 1 Nutritional, biochemical and hormonal profile in pregnant and nonpregnant rats that consumed control (CP and CNP) or low-protein diets (LPP and LPNP)
Full size table

In islets that were administered 5.6 mmol/L glucose, a two-way ANOVA revealed a significant effect of the interaction between the nutritional and physiological status (F1,24 = 8.03, P < 0.01). Thus, insulin secretion in the LPP, CP and CN groups was increased compared to that of the LPNP group (Figure 1A). Insulin secretion in the presence of 8.3 mmol/L glucose was influenced only by the physiological status (F1,36 = 90.13, P < 0.001); i.e., islets from pregnant (LPP and CP) rats released more insulin than islets from non-pregnant (LPNP and CN) rats (Figure 1B).

Initially, the capacity for detecting Cx36 mRNA and protein expression was tested in tissues that are known to express high levels of this protein, such as the brain, and tissues known to express undetectable levels, such as the heart (Figure 2A and 2B).In LPNP islets, Cx36 mRNA and protein expression was lower than in CN islets. Pregnancy decreased the Cx36 mRNA and protein expression in CP islets, and Cx36 expression did not change in LPP islets. Thus, the expression of Cx36 mRNA and protein was similar in LPP, LPNP and CP islets (Figure 2C and 2D).

Figure 1
figure 1

Glucose stimulation of insulin secretion by islets from non-pregnant controls (CN), pregnant controls (CP), low-protein non-pregnant rats (LPNP) and low-protein pregnant rats (LPP). Groups of 5 islets were incubated for 90 min in Krebs-bicarbonate medium containing (A) 5.6 or (B) 8.3 mmol/L glucose. The columns represent the cumulative 90-min insulin secretion and are the means ± SD of 5–9 independent experiments. Columns with different superscript minuscule letters are significantly different by two-way ANOVA followed by a least significant difference (LSD) test (P < 0.05).

Full size image
Figure 2
figure 2

Cx36 mRNA and protein expression in islets from non-pregnant controls (CN), pregnant controls (CP), low-protein non-pregnant rats (LPNP) and low-protein pregnant rats (LPP). (A) and (B) Cx36 mRNA and protein expression in a heart sample (negative control), brain (positive control) and islets, respectively. (C) and (D) Cx36 mRNA and protein expression in islets from pregnant and non-pregnant rats fed control or low-protein diets. The Cx36 mRNA content was normalized to RPS29 mRNA. The columns represent the means ± SD of 3–5 independent experiments. Columns with different superscript minuscule letters are significantly different by two-way ANOVA followed by a least significant difference (LSD) test (P < 0.05).

Full size image

The ability to detect Cx43 mRNA and protein expression was tested in liver (negative control) and heart (positive control), which express undetectable and high levels, respectively, of this connexin (Figure 3A and 3B). Cx43 mRNA expression was lower in LPP and LPNP islets than in CP and CN islets (F1,10 = 13.54, P < 0.01) (Figure 3C). The Cx43 protein content did not differ among the experimental groups (Figure 3D). The phospho-[Ser279/282]-Cx43 content was elevated in CP islets when compared to the other groups (Figure 3E).

As expected, we detected high β-catenin mRNA expression and protein content in a heart sample (Figure 4A and 4B). The expression of β-catenin mRNA (Figure 4C) and protein (Figure 4D) did not differ between LPP and LPNP islets and was reduced in the CP group compared to the CN group.

Islets from the CP group exhibited lower expression of β-actin mRNA when compared with the CN group, and β-actin expression was similar in the LPP and LPNP islets (Figure 5).

Figure 3
figure 3

Cx43 mRNA and protein expression in islets from non-pregnant controls (CN), pregnant controls (CP), low-protein non-pregnant rats (LPNP) and low-protein pregnant rats (LPP). (A) and (B) Cx43 mRNA and protein expression in a liver sample (negative control), heart (positive control) and islets, respectively. (C) and (D) Cx43 mRNA and protein expression in islets from pregnant and non-pregnant rats fed control or low-protein diets. The mRNA concentration of Cx43 is expressed relative to RPS29 mRNA. (E) Phospho-[Ser279/282]-Cx43 content in islets from pregnant and non-pregnant rats fed control or low-protein diets. The columns represent the means ± SD of 3–5 independent experiments. Columns with different superscript minuscule letters are significantly different by two-way ANOVA followed by a least significant difference (LSD) test (P < 0.05).

Full size image
Figure 4
figure 4

β-catenin mRNA and protein expression in islets from non-pregnant controls (CN), pregnant controls (CP), low-protein non-pregnant rats (LPNP) and low-protein pregnant rats (LPP). (A) and (B) β-catenin mRNA and protein expression in a heart sample (positive control) and islets. (C) and (D) β-catenin mRNA and protein expression in islets from pregnant and non-pregnant rats fed control or low-protein diets. The mRNA concentration of β-catenin is expressed relative to RPS29 mRNA. The columns represent the means ± SD of 3–6 independent experiments. Columns with different superscript minuscule letters are significantly different by two-way ANOVA followed by a least significant difference (LSD) test (P < 0.05).

Full size image
Figure 5
figure 5

β-actin mRNA expression in islets from non-pregnant controls (CN), pregnant controls (CP), low-protein non-pregnant rats (LPNP) and low-protein pregnant rats (LPP). The mRNA concentration of β-actin is expressed relative to RPS29 mRNA. The columns represent the means ± SD of 3–4 independent experiments. Columns with different superscript minuscule letters are significantly different by two-way ANOVA followed by a least significant difference (LSD) test (P < 0.05).

Full size image

Discussion

In the present study, non-pregnant rats fed a low-protein diet exhibited increased food intake, in agreement with a previous report that mild protein restriction can result in hyperphagia [41]. Despite hyperphagia, the low-protein non-pregnant group ate half of the amount of protein ingested by control non-pregnant group. Pregnancy also produces hyperphagia [41–43], and the pregnant rats in this study exhibited a higher food intake that resulted in significant body weight gain and a consequent higher final body weight in comparison to the non-pregnant rats. Thus, a short duration of mild protein restriction during pregnancy did not alter the food-related behavior or somatic profile of the rats, corroborating previous observations [44].

Interestingly, protein restriction reduced the Cx36 transcript levels in pancreatic islets, and pregnancy reduced the Cx36 transcript levels in islets from rats maintained on the control diet. This pattern was confirmed by determination of the Cx36 protein content. Moreover, our data did not show a correlation between Cx36 expression and insulin secretion at physiological or basal glucose concentrations. Under physiological conditions, the pregnant rats exhibited higher insulin secretion than non-pregnant rats, which is in agreement with a previous study [2]. The unaltered insulin secretion exhibited by isolated islets incubated with 5.6 mmol/L glucose coincided with the unchanged basal serum insulin levels, although we observed a trend of increased insulinemia in both pregnant groups. Recently, we evaluated the kinetics of insulin release by isolated islets, and we verified that the mean level of insulin secretion during 20 minutes of perfusion with a low glucose concentration (2.8 mmol/L) was higher in pregnant rats, coinciding with basal hyperinsulinemia and low glucemia, regardless of the amount dietary protein (unpublished data). The hypoglycemia that is typical of normal pregnancy [45] was also observed in our pregnant rats. However, neither protein deprivation nor pregnancy altered the insulin:glucose ratio (which was used here as an indicator of insulin resistance), although the increase in the insulin:glucose ratio observed in pregnant rats approached statistical significance. Thus, Cx36 suppression in pancreatic islets from low protein non-pregnant rats and in islets from pregnant rats did not induce insulin resistance or glucose intolerance.

An important component of optimal long-term glucose homeostasis is the ability of the pancreatic beta-cell mass to vary its activity according to insulin requirements [46]. The beta-to-beta cell communication mediated by connexins is implicated in the regulation of the beta-cell mass during pregnancy [47], and Cx43 isoforms have been shown to increase the islet size or insulin content [25]. Thus, we investigated if protein restriction during pregnancy modulates Cx43 expression in pancreatic islets. We identified Cx43 in pancreatic islets, confirming the findings of other authors who showed that Cx43 is present in pancreatic islets cultured with prolactin [21] and that Cx43 is specifically expressed on the intra-islet endothelium rather than on β-cells [48]. Although we observed reduced levels of Cx43 mRNA in malnourished rats, the individual variations in the Cx43 protein levels were sufficient to mask the differences among our experimental groups. Additionally, the duration of exposure a low-protein diet may not have been sufficient to negatively modulate the translation process.

Cx43 is a MAP kinase substrate that, when phosphorylated on Ser279 and Ser282, disrupts gap junctions and initiates the down-regulation of gap junctional communication [49]. We found that the phospho-[Ser279/282]-Cx43 content was increased during normal pregnancy. However, the consumption of a low-protein diet during pregnancy did not result in an alteration of Cx43 phosphorylation, which was lower compared with the levels observed in islets from normal pregnant rats. The meaning of this result in pancreatic islets is still not clear; however, at least in epithelial cells, an increase in the phosphorylation of Cx43 appears to regulate its trafficking to the plasma membrane and its assembly into gap junctions [50]. Evidence exists that Cx43 phosphorylation may trigger its internalization and degradation [51]. The combined effects of phosphorylation and protein degradation by a proteasome-dependent mechanism contribute to the regulation of Cx43 stability in the plasma membrane and intracellular communication through gap junctions [52]. Lastly, in vascular smooth muscle cells, the proliferation is controlled through MAP kinase phosphorylation of Cx43 [53].

Important cellular processes, such as cell proliferation and growth, are partly regulated by connexin-cadherin interactions [54], and β-catenin plays a crucial role in cell adhesion in several epithelial cell types by modulating the linkage of cadherins to α-catenin, which in turn interacts with the actin cytoskeleton [55, 56]. Recently, it was shown that E-cadherin negatively regulates β-cell proliferation by reducing the levels of β-catenin in the nucleus, resulting in decreased D-cyclin levels [57]. In rodents, several lines of evidence suggest that prolactin (PRL) and/or placental lactogens (PLs) are responsible for the pregnancy-associated changes in the β-cell mass [58]. In vitro prolactin treatment induces higher β-catenin expression in islets cells, and high β-catenin correlates with increased Cx43 expression. We verified that in normal pregnancy, the β-catenin transcript levels and protein content were reduced, and no correlation was observed between the Cx43 protein and β-catenin content. However, our studies were performed on day 15 of pregnancy, and the levels of prolactin are known increase immediately before delivery [59]. We also observed that the decrease in the level of β-catenin mRNA correlated with low levels of β-actin mRNA during normal pregnancy. Thus, the profile of β-catenin protein expression as well as Cx43 phosphorylation observed in our normal pregnant groups coincides with the beginning of the decline of the proliferative phase of β-cells [58]. In contrast, the consumption of a low-protein diet during pregnancy did not alter the levels of β-catenin and β-actin transcripts; however, it did result in reduced β-catenin protein content, which had a level similar to the value observed during normal pregnancy. Considering the data on Cx43 phosphorylation and β-catenin together, it is reasonable to speculate that cellular processes that regulate the β-cell mass were reduced by the low-protein diet during pregnancy. However, these alterations did not contribute to an impairment of glucose tolerance.

Conclusion

In conclusion, our results indicate that short-term protein restriction during pregnancy prevented the Cx43 phosphorylation, but this event did not interfere in the insulin secretion in the basal and physiological glucose ranges.

Methods

Animals and diet

The animal experiments were approved by the Institutional Committee for Ethics in Animal Experimentation (Universidade Federal de Mato Grosso). Non-pregnant Wistar rats (90 days old) were obtained from the university’s breeding colony. Mating was achieved by housing males with females overnight, and pregnancy was confirmed by the examination of vaginal smears for the presence of sperm. Pregnant and non-pregnant rats were each randomly assigned to two diet groups: control and low-protein. The control non-pregnant (CN) and pregnant (CP) groups were fed a 17% protein diet, and the low-protein non-pregnant (LPNP) and pregnant (LPP) groups were fed a 6% protein diet from days 1 to 15 of pregnancy. The diets were isocaloric, and the energy difference due to the reduction of dietary protein was compensated for by an equivalent change in the level of dietary carbohydrate, as described previously [40]. During the experimental period, the rats had free access to food and water and were housed at 22°C with a 12-h light:dark cycle. The food intake and body weight were recorded three times per week. At the end of this experimental period, the rats were weighed and killed by decapitation. Blood samples were collected and allowed to clot. Sera were stored at -20°C for the subsequent measurement of insulin by radioimmunoassay [60] and glucose by the oxidase-peroxidase system [61].

Islet isolation and insulin secretion

The pancreas was removed from the rats and digested with collagenase type V (Sigma-Aldrich, CA, USA), as described elsewhere [62]. In the first series of experiments, groups of five islets were incubated for 90 min at 37°C in Krebs-bicarbonate buffer containing glucose (5.6 and 8.3 mmol/L) and equilibrated with a mixture of 95% O2 and 5% CO2 to result in a pH of 7.4. The incubation medium contained (in mmol/L): NaCl, 115; KCl, 5; CaCl2, 2.56; MgCl2, 1; NaHCO3, 24; and bovine serum albumin 3 g/L (Sigma-Aldrich, CA, USA). The insulin released was measured by RIA using rat insulin as a standard [60].

Semiquantitative RT-PCR

Total RNA from 1,000 isolated and separated islets was extracted using TRIzol reagent (Life Technologies, Gaithersburg, MD). All of the reagents used in the experiments for RT-PCR were from Invitrogen (Carlsbad, CA, USA). For PCR analysis, RNA (2 μg) was reverse-transcribed using oligo (DT) primers. The resulting cDNA was amplified by PCR using oligonucleotides complementary to sequences in the Cx36 gene (5′- CGGTGTACGATGATGAGCAG -3′ and 5′- GAGTACCGGCGTTCTCTCTG -3′), Cx43 gene (5′-CCGACGACAACCAGAATGCC -3′ and 5′-CTTGGGATAGCTGGGCGGAAC-3′), β-catenin gene (5′-GCCAGTGGATTCCGTACTGT and 5′-GAGCTTGCTTTCCTGATTGC-3′), β-actin gene (5′-CAACCTTCTTGCAGCTCCTC-3′ and 5′-TTCTGACCCATACCCACCAT-3′) and RPS-29 gene (5′-CTGAAGGCAAGATGGGTCAC-3′ and 5′- CCATTCAGGTCGCTTAGTCC-3′). RPS-29 served as the internal control. The primers were from Prodimol (Belo Horizonte, MG, Brazil). The semiquantitative RT-PCR was performed in a 15-μL reaction volume containing 1 μL cDNA, 0.2 mM dNTP (dATP, dCTP, dGTP and dTTP), 1 mM MgCl2, 100% (v/v) 10 × PCR buffer, appropriate oligonucleotides primers (0.075 μM, 0.3 μM and 0.6 μM for RPS-29, Cx43, β-catenin, β-actin and Cx36, respectively) and 1 U Taq polymerase. The RT-PCR amplification conditions were as follows: for RPS-29 (internal control) and β-actin, 5 min at 94°C followed by 27 cycles of 45 s at 94°, 45 s at 59° and 1 min at 72°C; for Cx36, 5 min at 94°C followed by 35 cycles of 45 s at 94°, 45 s at 62° and 1 min at 72°C; for β-catenin, 5 min at 94°C followed by 27 cycles of 45 s at 94°, 45 s at 45° and 1 min at 72°C; and for Cx43, 5 min at 94°C followed by 30 cycles of 45 s at 50°, 45 s at 62° and 1 min at 72°C. The RT-PCR products were separated on a 1.5% agarose gel in 1 × Tris-borate-EDTA buffer and stained with ethidium bromide (USB Corporation, Cleveland, Ohio, USA). All of the assays included a negative control. The absence of contamination was confirmed by reverse transcriptase-negative RNA samples. The relative band intensities were determined by densitometry, and the ratio of Cx36, Cx43, β-catenin and β-actin to RPS-29 gene expression was calculated for each sample.

Western blotting

After isolation, groups of islets were pelleted by centrifugation (15,000 x g) and then resuspended in 50–100 μL of homogenization buffer containing protease and phosphatase inhibitors [63, 64]. The islets were sonicated, and the total protein content was determined with a biuret (Labtest Diagnóstica, Lagoa Santa, MG, Brazil). Samples containing 200 μg of protein from each experimental group were incubated for 1 h at 37°C with 4 × concentrated Laemmli sample buffer (1 mmol sodium phosphate/L, pH 7.8; 0.1% bromophenol blue; 50% glycerol; 10% SDS; 2% mercaptoethanol) (4:1, v:v) and assayed on 12% polyacrylamide gels at 120 V for 90 min. The electrotransfer of proteins to nitrocellulose membranes (Bio-Rad) was performed for 2 h at 120 V in buffer lacking methanol and SDS. After checking the transfer efficiency by Ponceau S staining, the membranes were blocked with 5% skimmed milk in Tween-Tris-buffered saline (TTBS) (10 mmol Tris/L, 150 mmol NaCl/L, 0.5% Tween 20) overnight at 4°C. Cx36, phospho-[Ser279/282]-Cx43 and β-catenin were detected on the membranes after a 2-h incubation at room temperature with anti-Cx36 (goat polyclonal), anti-phospho-[Ser279/282]-Cx43 (goat polyclonal) and anti-β-catenin (mouse monoclonal) antibodies (Santa Cruz Biotechnology (Santa Cruz, CA, USA) and Zymed Laboratories (Invitrogen, CA, USA), respectively; diluted 1:500, 1:1000 and 1:1000, respectively, in TTBS containing 3% dry skimmed milk). To detect Cx43, samples containing 200 μg of total protein were incubated overnight at 4°C with 10 μL of anti-Cx43 mouse polyclonal IgG (Zymed, Invitrogen, CA, USA), followed by the addition of Protein A Sepharose (40 μL), transfer to nitrocellulose membranes, and blotting with a specific horseradish peroxidase-conjugated secondary antibody (Zymed, Invitrogen, CA, USA) diluted in blocking buffer (3% BSA 1:1500). Enhanced chemiluminescence (SuperSignal West Pico, Pierce) was used for detection. Band intensities were quantified by optical densitometry of the developed autoradiogram using Scion Image Beta software.

Statistical analysis

The results were expressed as the mean ± SD for the number of rats (n) indicated. For islets, n refers to the number of experiments performed. Levene’s test for the homogeneity of variances was used initially to determine the fit of the data to the parametric ANOVA assumptions [65]. The data were analyzed by two-way ANOVA (nutritional status and physiological status). When necessary, these analyses were followed by LSD’s honestly significant difference test to determine the significance of individual differences. The level of significance was set at P < 0.05. The data were analyzed using the Statistic Software package (Statsoft).

References

  1. Weinhaus AJ, Stout LE, Sorenson RL: Glucokinase, hexokinase, glucose transporter 2, and glucose metabolism in islets during pregnancy and prolactin-treated islets in vitro: mechanisms for long term up-regulation of islets. Endocrinology 1996, 137:1640–1649.

    CAS  PubMed  Google Scholar 

  2. Milanski M, Arantes VC, Ferreira F, de Barros Reis MA, Carneiro EM, Boschero AC, Collares-Buzato CB, Latorraca MQ: Low-protein diets reduce PKAalpha expression in islets from pregnant rats. J Nutr 2005, 135:1873–1878.

    CAS  PubMed  Google Scholar 

  3. de Mazancourt P, Carneiro EM, Atwater I, Boschero AC: Prolactin treatment increases GLUT2 but not the G protein subunit content in cell membranes from cultured neonatal rat islets. FEBS Lett 1994, 343:137–140. 10.1016/0014-5793(94)80305-6

    Article  CAS  PubMed  Google Scholar 

  4. Green IC, Perrin D, Howell SL: Insulin release in isolated islets of Langerhans of pregnant rats. Relationship between glucose metabolism and cyclic AMP. Horm Metab Res 1978, 10:32–35. 10.1055/s-0028-1093476

    Article  CAS  PubMed  Google Scholar 

  5. Brelje TC, Sorenson RL: Nutrient and hormonal regulation of the threshold of glucose-stimulated insulin secretion in isolated rat pancreases. Endocrinology 1988, 123:1582–1590. 10.1210/endo-123-3-1582

    Article  CAS  PubMed  Google Scholar 

  6. Van Assche FA: Quantitative morphologic and histoenzymatic study of the endocrine pancreas in nonpregnant and pregnant rats. Am J Obstet Gynecol 1974, 118:39–41.

    CAS  PubMed  Google Scholar 

  7. Bone AJ, Taylor KW: Metabolism adaptation to pregnancy shown by increased biosynthesis of insulin in islets of Langerhans isolated from pregnant rats. Nature 1976, 262:501–502. 10.1038/262501a0

    Article  CAS  PubMed  Google Scholar 

  8. Sheridan JD, Anaya PA, Parsons JA, Sorenson RL: Increased dye coupling in pancreatic islets from rats in late-term pregnancy. Diabetes 1988, 37:908–911. 10.2337/diab.37.7.908

    Article  CAS  PubMed  Google Scholar 

  9. Rao RH: Chronic undernutrition may accentuate the beta cell dysfunction of type 2 diabetes. Diabetes Res Clin Pract 1990, 8:125–130. 10.1016/0168-8227(90)90022-L

    Article  CAS  PubMed  Google Scholar 

  10. Rasschaert J, Reusens B, Dahri S, Sener A, Remacle C, Hoet JJ, Malaisse WJ: Impaired activity of rat pancreatic islet mitochondrial glycerophosphate dehydrogenase in protein malnutrition. Endocrinology 1995, 136:2631–2634.

    CAS  PubMed  Google Scholar 

  11. Boschero AC, Szpak-Glasman M, Carneiro EM, Bordin S, Paul I, Rojas E, Atwater I: Oxotremorine-m potentiation of glucose-induced insulin release from rat islets involves M3 muscarinic receptors. Am J Physiol 1995, 268:E336–342.

    CAS  PubMed  Google Scholar 

  12. Latorraca MQ, Carneiro EM, Mello MA, Boschero AC: Reduced insulin secretion in response to nutrients in islets from malnourished young rats is associated with a diminished calcium uptake. J Nutr Biochem 1999, 10:37–43. 10.1016/S0955-2863(98)00080-1

    Article  CAS  PubMed  Google Scholar 

  13. Ferreira F, Barbosa HC, Stoppiglia LF, Delghingaro-Augusto V, Pereira EA, Boschero AC, Carneiro EM: Decreased insulin secretion in islets from rats fed a low protein diet is associated with a reduced PKAalpha expression. J Nutr 2004, 134:63–67.

    CAS  PubMed  Google Scholar 

  14. Ferreira F, Filiputti E, Arantes VC, Stoppiglia LF, Araujo EP, Delghingaro-Augusto V, Latorraca MQ, Toyama MH, Boschero AC, Carneiro EM: Decreased cholinergic stimulation of insulin secretion by islets from rats fed a low protein diet is associated with reduced protein kinase calpha expression. J Nutr 2003, 133:695–699.

    CAS  PubMed  Google Scholar 

  15. Meda P: The role of gap junction membrane channels in secretion and hormonal action. J Bioenerg Biomembr 1996, 28:369–377. 10.1007/BF02110113

    Article  CAS  PubMed  Google Scholar 

  16. Serre-Beinier V, Mas C, Calabrese A, Caton D, Bauquis J, Caille D, Charollais A, Cirulli V, Meda P: Connexins and secretion. Biol Cell 2002, 94:477–492. 10.1016/S0248-4900(02)00024-2

    Article  CAS  PubMed  Google Scholar 

  17. Le Gurun S, Martin D, Formenton A, Maechler P, Caille D, Waeber G, Meda P, Haefliger JA: Connexin-36 contributes to control function of insulin-producing cells. J Biol Chem 2003, 278:37690–37697. 10.1074/jbc.M212382200

    Article  CAS  PubMed  Google Scholar 

  18. Michon L, Nlend Nlend R, Bavamian S, Bischoff L, Boucard N, Caille D, Cancela J, Charollais A, Charpantier E, Klee P, et al.: Involvement of gap junctional communication in secretion. Biochim Biophys Acta 2005, 1719:82–101. 10.1016/j.bbamem.2005.11.003

    Article  CAS  PubMed  Google Scholar 

  19. Nlend RN, Michon L, Bavamian S, Boucard N, Caille D, Cancela J, Charollais A, Charpantier E, Klee P, Peyrou M, et al.: Connexin36 and pancreatic beta-cell functions. Arch Physiol Biochem 2006, 112:74–81. 10.1080/13813450600712019

    Article  CAS  PubMed  Google Scholar 

  20. Charpantier E, Cancela J, Meda P: Beta cells preferentially exchange cationic molecules via connexin 36 gap junction channels. Diabetologia 2007, 50:2332–2341. 10.1007/s00125-007-0807-9

    Article  CAS  PubMed  Google Scholar 

  21. Collares-Buzato CB, Leite AR, Boschero AC: Modulation of gap and adherens junctional proteins in cultured neonatal pancreatic islets. Pancreas 2001, 23:177–185. 10.1097/00006676-200108000-00008

    Article  CAS  PubMed  Google Scholar 

  22. Serre-Beinier V, Le Gurun S, Belluardo N, Trovato-Salinaro A, Charollais A, Haefliger JA, Condorelli DF, Meda P: Cx36 preferentially connects beta-cells within pancreatic islets. Diabetes 2000, 49:727–734. 10.2337/diabetes.49.5.727

    Article  CAS  PubMed  Google Scholar 

  23. Charollais A, Serre V, Mock C, Cogne F, Bosco D, Meda P: Loss of alpha 1 connexin does not alter the prenatal differentiation of pancreatic beta cells and leads to the identification of another islet cell connexin. Dev Genet 1999, 24:13–26. 10.1002/(SICI)1520-6408(1999)24:1/2<13::AID-DVG3>3.0.CO;2-N

    Article  CAS  PubMed  Google Scholar 

  24. Johnstone SR, Best AK, Wright CS, Isakson BE, Errington RJ, Martin PE: Enhanced connexin 43 expression delays intra-mitotic duration and cell cycle traverse independently of gap junction channel function. J Cell Biochem 2010, 110:772–782. 10.1002/jcb.22590

    Article  PubMed Central  CAS  PubMed  Google Scholar 

  25. Klee P, Lamprianou S, Charollais A, Caille D, Sarro R, Cederroth M, Haefliger JA, Meda P: Connexin implication in the control of the murine beta-cell mass. Pediatr Res 2011, 70:142–147.

    Article  CAS  PubMed  Google Scholar 

  26. Jonkers FC, Jonas JC, Gilon P, Henquin JC: Influence of cell number on the characteristics and synchrony of Ca2+ oscillations in clusters of mouse pancreatic islet cells. J Physiol 1999,520(Pt 3):839–849.

    Article  PubMed Central  CAS  PubMed  Google Scholar 

  27. Collares-Buzato CB, Carvalho CP, Furtado AG, Boschero AC: Upregulation of the expression of tight and adherens junction-associated proteins during maturation of neonatal pancreatic islets in vitro. J Mol Histol 2004, 35:811–822. 10.1007/s10735-004-1746-0

    Article  CAS  PubMed  Google Scholar 

  28. Meyer RA, Laird DW, Revel JP, Johnson RG: Inhibition of gap junction and adherens junction assembly by connexin and A-CAM antibodies. J Cell Biol 1992, 119:179–189. 10.1083/jcb.119.1.179

    Article  CAS  PubMed  Google Scholar 

  29. Hauge-Evans AC, Squires PE, Persaud SJ, Jones PM: Pancreatic beta-cell-to-beta-cell interactions are required for integrated responses to nutrient stimuli: enhanced Ca2+ and insulin secretory responses of MIN6 pseudoislets. Diabetes 1999, 48:1402–1408. 10.2337/diabetes.48.7.1402

    Article  CAS  PubMed  Google Scholar 

  30. Bernard-Kargar C, Kassis N, Berthault MF, Pralong W, Ktorza A: Sialylated form of the neural cell adhesion molecule (NCAM): a new tool for the identification and sorting of beta-cell subpopulations with different functional activity. Diabetes 2001,50(Suppl 1):S125–130.

    Article  CAS  PubMed  Google Scholar 

  31. Lilla V, Webb G, Rickenbach K, Maturana A, Steiner DF, Halban PA, Irminger JC: Differential gene expression in well-regulated and dysregulated pancreatic beta-cell (MIN6) sublines. Endocrinology 2003, 144:1368–1379. 10.1210/en.2002-220916

    Article  CAS  PubMed  Google Scholar 

  32. Geiger B, Yehuda-Levenberg S, Bershadsky AD: Molecular interactions in the submembrane plaque of cell-cell and cell-matrix adhesions. Acta Anat (Basel) 1995, 154:46–62. 10.1159/000147751

    Article  CAS  Google Scholar 

  33. Lerch MM, Lutz MP, Weidenbach H, Muller-Pillasch F, Gress TM, Leser J, Adler G: Dissociation and reassembly of adherens junctions during experimental acute pancreatitis. Gastroenterology 1997, 113:1355–1366. 10.1053/gast.1997.v113.pm9322531

    Article  CAS  PubMed  Google Scholar 

  34. Toyoda E, Doi R, Koizumi M, Kami K, Ito D, Mori T, Fujimoto K, Nakajima S, Wada M, Imamura M: Analysis of E-, N-cadherin, alpha-, beta-, and gamma-catenin expression in human pancreatic carcinoma cell lines. Pancreas 2005, 30:168–173. 10.1097/01.mpa.0000148514.69873.85

    Article  CAS  PubMed  Google Scholar 

  35. Rutland CS, Latunde-Dada AO, Thorpe A, Plant R, Langley-Evans S, Leach L: Effect of gestational nutrition on vascular integrity in the murine placenta. Placenta 2007, 28:734–742. 10.1016/j.placenta.2006.07.001

    Article  CAS  PubMed  Google Scholar 

  36. Ravier MA, Guldenagel M, Charollais A, Gjinovci A, Caille D, Sohl G, Wollheim CB, Willecke K, Henquin JC, Meda P: Loss of connexin36 channels alters beta-cell coupling, islet synchronization of glucose-induced Ca2+ and insulin oscillations, and basal insulin release. Diabetes 2005, 54:1798–1807. 10.2337/diabetes.54.6.1798

    Article  CAS  PubMed  Google Scholar 

  37. Benninger RK, Head WS, Zhang M, Satin LS, Piston DW: Gap junctions and other mechanisms of cell-cell communication regulate basal insulin secretion in the pancreatic islet. J Physiol 2011, 589:5453–5466. 10.1113/jphysiol.2011.218909

    Article  PubMed Central  CAS  PubMed  Google Scholar 

  38. Pizarro-Delgado J, Fasciani I, Temperan A, Romero M, Gonzalez-Nieto D, Alonso-Magdalena P, Nualart-Marti A, Estil'les E, Paul DL, Martin-del-Rio R, et al.: Inhibition of connexin 36 hemichannels by glucose contributes to the stimulation of insulin secretion. Am J Physiol Endocrinol Metab 2014, 306:E1354–1366. 10.1152/ajpendo.00358.2013

    Article  CAS  PubMed  Google Scholar 

  39. Wellershaus K, Degen J, Deuchars J, Theis M, Charollais A, Caille D, Gauthier B, Janssen-Bienhold U, Sonntag S, Herrera P, et al.: A new conditional mouse mutant reveals specific expression and functions of connexin36 in neurons and pancreatic beta-cells. Exp Cell Res 2008, 314:997–1012. 10.1016/j.yexcr.2007.12.024

    Article  CAS  PubMed  Google Scholar 

  40. Souza Dde F, Ignacio-Souza LM, Reis SR, Reis MA, Stoppiglia LF, Carneiro EM, Boschero AC, Arantes VC, Latorraca MQ: A low-protein diet during pregnancy alters glucose metabolism and insulin secretion. Cell Biochem Funct 2012, 30:114–121. 10.1002/cbf.1824

    Article  PubMed  Google Scholar 

  41. Du F, Higginbotham DA, White BD: Food intake, energy balance and serum leptin concentrations in rats fed low-protein diets. J Nutr 2000, 130:514–521.

    CAS  PubMed  Google Scholar 

  42. Herrera E, Lasuncion MA, Palacin M, Zorzano A, Bonet B: Intermediary metabolism in pregnancy. First theme of the Freinkel era. Diabetes 1991,40(Suppl 2):83–88.

    Article  PubMed  Google Scholar 

  43. Frontera M, Pujol E, Rodriguez-Cuenca S, Catala-Niell A, Roca P, Garcia-Palmer FJ, Gianotti M: Rat brown adipose tissue thermogenic features are altered during mid-pregnancy. Cell Physiol Biochem 2005, 15:203–210. 10.1159/000086407

    Article  CAS  PubMed  Google Scholar 

  44. Macedo GS, Ferreira CL, Menegaz A, Arantes VC, Veloso RV, Carneiro EM, Boschero AC, Oller do Nascimento CM, Latorraca MQ, Gomes-da-Silva MH: Correlation of serum leptin and insulin levels of pregnant protein-restricted rats with predictive obesity variables. Braz J Med Biol Res 2008, 41:519–525. 10.1590/S0100-879X2008000600014

    Article  CAS  PubMed  Google Scholar 

  45. Herrera E, Munoz C, Lopez-Luna P, Ramos P: Carbohydrate-lipid interactions during gestation and their control by insulin. Braz J Med Biol Res 1994, 27:2499–2519.

    CAS  PubMed  Google Scholar 

  46. Kargar C, Ktorza A: Anatomical versus functional beta-cell mass in experimental diabetes. Diabetes Obes Metab 2008,10(Suppl 4):43–53.

    Article  CAS  PubMed  Google Scholar 

  47. Genevay M, Pontes H, Meda P: Beta cell adaptation in pregnancy: a major difference between humans and rodents? Diabetologia 2010, 53:2089–2092. 10.1007/s00125-010-1848-z

    Article  CAS  PubMed  Google Scholar 

  48. Theis M, Mas C, Doring B, Degen J, Brink C, Caille D, Charollais A, Kruger O, Plum A, Nepote V, et al.: Replacement by a lacZ reporter gene assigns mouse connexin36, 45 and 43 to distinct cell types in pancreatic islets. Exp Cell Res 2004, 294:18–29. 10.1016/j.yexcr.2003.09.031

    Article  CAS  PubMed  Google Scholar 

  49. Warn-Cramer BJ, Cottrell GT, Burt JM, Lau AF: Regulation of connexin-43 gap junctional intercellular communication by mitogen-activated protein kinase. J Biol Chem 1998, 273:9188–9196. 10.1074/jbc.273.15.9188

    Article  CAS  PubMed  Google Scholar 

  50. Lampe PD, TenBroek EM, Burt JM, Kurata WE, Johnson RG, Lau AF: Phosphorylation of connexin43 on serine368 by protein kinase C regulates gap junctional communication. J Cell Biol 2000, 149:1503–1512. 10.1083/jcb.149.7.1503

    Article  PubMed Central  CAS  PubMed  Google Scholar 

  51. Laird DW: Connexin phosphorylation as a regulatory event linked to gap junction internalization and degradation. Biochim Biophys Acta 2005, 1711:172–182. 10.1016/j.bbamem.2004.09.009

    Article  CAS  PubMed  Google Scholar 

  52. Girao H, Pereira P: Phosphorylation of connexin 43 acts as a stimuli for proteasome-dependent degradation of the protein in lens epithelial cells. Mol Vis 2003, 9:24–30.

    CAS  PubMed  Google Scholar 

  53. Johnstone SR, Kroncke BM, Straub AC, Best AK, Dunn CA, Mitchell LA, Peskova Y, Nakamoto RK, Koval M, Lo CW, et al.: MAPK phosphorylation of connexin 43 promotes binding of cyclin E and smooth muscle cell proliferation. Circ Res 2012, 111:201–211. 10.1161/CIRCRESAHA.112.272302

    Article  PubMed Central  CAS  PubMed  Google Scholar 

  54. Dbouk HA, Mroue RM, El-Sabban ME, Talhouk RS: Connexins: a myriad of functions extending beyond assembly of gap junction channels. Cell Commun Signal 2009, 7:4. 10.1186/1478-811X-7-4

    Article  PubMed Central  PubMed  Google Scholar 

  55. Adams CL, Nelson WJ, Smith SJ: Quantitative analysis of cadherin-catenin-actin reorganization during development of cell-cell adhesion. J Cell Biol 1996, 135:1899–1911. 10.1083/jcb.135.6.1899

    Article  CAS  PubMed  Google Scholar 

  56. Hinck L, Nathke IS, Papkoff J, Nelson WJ: Dynamics of cadherin/catenin complex formation: novel protein interactions and pathways of complex assembly. J Cell Biol 1994, 125:1327–1340. 10.1083/jcb.125.6.1327

    Article  CAS  PubMed  Google Scholar 

  57. Wakae-Takada N, Xuan S, Watanabe K, Meda P, Leibel RL: Molecular basis for the regulation of islet beta cell mass in mice: the role of E-cadherin. Diabetologia 2013, 56:856–866. 10.1007/s00125-012-2824-6

    Article  PubMed Central  CAS  PubMed  Google Scholar 

  58. Sorenson RL, Brelje TC: Adaptation of islets of Langerhans to pregnancy: beta-cell growth, enhanced insulin secretion and the role of lactogenic hormones. Horm Metab Res 1997, 29:301–307. 10.1055/s-2007-979040

    Article  CAS  PubMed  Google Scholar 

  59. Nadal A, Alonso-Magdalena P, Soriano S, Ropero AB, Quesada I: The role of oestrogens in the adaptation of islets to insulin resistance. J Physiol 2009, 587:5031–5037. 10.1113/jphysiol.2009.177188

    Article  PubMed Central  CAS  PubMed  Google Scholar 

  60. Scott AM, Atwater I, Rojas E: A method for the simultaneous measurement of insulin release and B cell membrane potential in single mouse islets of Langerhans. Diabetologia 1981, 21:470–475.

    Article  CAS  PubMed  Google Scholar 

  61. Trinder P: Determination of blood glucose using an oxidase-peroxidase system with a non-carcinogenic chromogen. J Clin Pathol 1969, 22:158–161. 10.1136/jcp.22.2.158

    Article  PubMed Central  CAS  PubMed  Google Scholar 

  62. Boschero AC, Szpak-Glasman M, Carneiro EM, Bordin S, Paul I, Rojas E, Atwater I: Oxotremorine-m potentiation of glucose-induced insulin release from rat islets involves M3 muscarinic receptors. Am J Physiol 1995, 268:E336–342.

    CAS  PubMed  Google Scholar 

  63. Kelley GG, Zawalich KC, Zawalich WS: Calcium and a mitochondrial signal interact to stimulate phosphoinositide hydrolysis and insulin secretion in rat islets. Endocrinology 1994, 134:1648–1654.

    CAS  PubMed  Google Scholar 

  64. Amaral ME, Ueno M, Carvalheira JB, Carneiro EM, Velloso LA, Saad MJ, Boschero AC: Prolactin-signal transduction in neonatal rat pancreatic islets and interaction with the insulin-signaling pathway. Horm Metab Res 2003, 35:282–289.

    Article  CAS  PubMed  Google Scholar 

  65. Sokal RR, Rohlf FJ: Biometry; the principles and practice of statistics in biological research. San Francisco: W. H. Freeman; 1969.

    Google Scholar 

Download references

Acknowledgments

This work was partly supported by the Fundação de Amparo à Pesquisa do Estado de Mato Grosso (FAPEMAT, grant number: 0786/2006) and Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq, grant number: 305155/2004-0). Celso Roberto Afonso provided technical assistance for the study. This work is part of a dissertation that was presented by Ana Flávia Marçal Pessoa as a partial requirement for the Master’s degree in Health Sciences at the School of Medical Sciences, UFMT.

Author information

Authors and Affiliations

  1. Mestrado em Ciências da Saúde, Faculdade de Ciências Médicas, Universidade Federal de Mato Grosso, Cuiabá, Mato Grosso, Brazil

    Ana Flávia Marçal-Pessoa & Cristiana dos Santos Barbosa Salvatierra

  2. Departamento de Ciências Básicas em Saúde, Faculdade de Ciências Médicas, Universidade Federal de Mato Grosso, Cuiabá, Mato Grosso, Brazil

    Carmen Lucia Bassi-Branco

  3. Departamento de Psicologia, Instituto de Educação, Universidade Federal de Mato Grosso, Cuiabá, Mato Grosso, Brazil

    Luiz Fabrizio Stoppiglia

  4. Departamento de Alimentos e Nutrição, Faculdade de Nutrição, Universidade Federal de Mato Grosso, Cuiabá, Mato Grosso, Brazil

    Letícia Martins Ignacio-Souza, Sílvia Regina de Lima Reis, Roberto Vilela Veloso, Marise Auxiliadora de Barros Reis, Vanessa Cristina Arantes & Márcia Queiroz Latorraca

  5. Departamento de Anatomia, Biologia Celular e Fisiologia e Biofísica, Instituto de Biologia, Universidade Estadual de Campinas, Campinas, SP, Brazil

    Everardo Magalhães Carneiro & Antonio Carlos Boschero

Authors
  1. Ana Flávia Marçal-Pessoa
    View author publications

    You can also search for this author in PubMed Google Scholar

  2. Carmen Lucia Bassi-Branco
    View author publications

    You can also search for this author in PubMed Google Scholar

  3. Cristiana dos Santos Barbosa Salvatierra
    View author publications

    You can also search for this author in PubMed Google Scholar

  4. Luiz Fabrizio Stoppiglia
    View author publications

    You can also search for this author in PubMed Google Scholar

  5. Letícia Martins Ignacio-Souza
    View author publications

    You can also search for this author in PubMed Google Scholar

  6. Sílvia Regina de Lima Reis
    View author publications

    You can also search for this author in PubMed Google Scholar

  7. Roberto Vilela Veloso
    View author publications

    You can also search for this author in PubMed Google Scholar

  8. Marise Auxiliadora de Barros Reis
    View author publications

    You can also search for this author in PubMed Google Scholar

  9. Everardo Magalhães Carneiro
    View author publications

    You can also search for this author in PubMed Google Scholar

  10. Antonio Carlos Boschero
    View author publications

    You can also search for this author in PubMed Google Scholar

  11. Vanessa Cristina Arantes
    View author publications

    You can also search for this author in PubMed Google Scholar

  12. Márcia Queiroz Latorraca
    View author publications

    You can also search for this author in PubMed Google Scholar

Corresponding author

Correspondence to Márcia Queiroz Latorraca.

Additional information

Competing interests

The authors declare that they have no competing interests.

Authors’ contributions

AFMP was responsible for conducting the experiments, acquiring and analyzing the data and writing the paper; MQL and VCA designed the research and wrote the paper; SRLR, LMIS, LFS, CSBS and RVV performed the islet isolation, insulin secretion assay, Western blotting and semiquantitative RT-PCR; CLBB and MABR analyzed the semiquantitative RT-PCR; EMC and ACB were involved in the revision of the manuscript; AFMP had primary responsibility for the final content. All authors read and approved the final manuscript.

Rights and permissions

Open Access  This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made.

The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder.

To view a copy of this licence, visit https://creativecommons.org/licenses/by/4.0/.

The Creative Commons Public Domain Dedication waiver (https://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated in a credit line to the data.

Reprints and permissions

About this article

Check for updates. Verify currency and authenticity via CrossMark

Cite this article

Marçal-Pessoa, A.F., Bassi-Branco, C.L., Salvatierra, C.d.S.B. et al. A low-protein diet during pregnancy prevents modifications in intercellular communication proteins in rat islets. biol res 48, 3 (2015). https://doi.org/10.1186/0717-6287-48-3

Download citation

  • Received:

  • Accepted:

  • Published:

  • DOI: https://doi.org/10.1186/0717-6287-48-3

Keywords

Biological Research

ISSN: 0717-6287

Contact us