Skip to main content
Download PDF
  • Research article
  • Open access
  • Published:

Identification and expression analysis of two steamer-like retrotransposons in the Chilean blue mussel (Mytilus chilensis)

Biological Research volume 57, Article number: 17 (2024) Cite this article

Abstract

Background

Disseminated neoplasia (DN) is a proliferative cell disorder of the circulatory system of bivalve mollusks. The disease is transmitted between individuals and can also be induced by external chemical agents such as bromodeoxyuridine. In Mya arenaria, we have cloned and characterized an LTR-retrotransposon named Steamer. Steamer mRNA levels and gene copy number correlates with DN and can be used as a marker of the disease. So far, the only mollusk where a retrotransposon expression relates to DN is Mya arenaria. On the other hand, it has been reported that the Chilean blue mussel Mytilus chilensis can also suffers DN. Our aim was to identify retrotransposons in Mytilus chilensis and to study their expression levels in the context of disseminated neoplasia.

Results

Here we show that 7.1% of individuals collected in August 2018, from two farming areas, presents morphological characteristics described in DN. Using Steamer sequence to interrogate the transcriptome of M. chilensis we found two putative retrotransposons, named Steamer-like elements (MchSLEs). MchSLEs are present in the genome of M. chilensis and MchSLE1 is indeed an LTR-retrotransposon. Neither expression, nor copy number of the reported MchSLEs correlate with DN status but both are expressed at different levels among individual animals. We also report that in cultured M. chilensis haemocytes MchSLEs1 expression can be induced by bromodeoxyuridine.

Conclusions

We conclude that SLEs present in Mytilus chilensis are differentially expressed among individuals and do not correlate with disseminated neoplasia. Treatment of haemocytes with a stressor like bromodeoxyuridine induces expression of MchSLE1 suggesting that in Mytilus chilensis environmental stressors can induce activation of LTR-retrotransposon.

Background

Disseminated neoplasia (DN) is a proliferative cell disorder of the circulating cells of bivalve mollusks that has been reported in at least 15 species of marine bivalves world-wide [1,2,3]. DNs are characterized by the presence of large rounded or oval cells with a high nucleus: cytoplasm ratio, high frequency of mitotic figures in the connective tissue, sinuses, and organs. These cells also have low adherence an pseudopodia formation in fresh preparations (revised by Carballal et al. [3]). In many bivalve species the disease is progressive, and the replacement of normal cells implies the loss of the normal tissue and organs architecture leading to death.

Elucidating the etiology of DN has been a key issue since its discovery, now we know that in at least eight bivalve species [4,5,6,7,8] the disease is transmitted between individuals through a cancer cell line, this is called bivalve transmissible neoplasia (BTN). This does not exclude the possibility of other factors influencing the development of de novo neoplasia in other species. The diagnostics of DNs cannot be performed by external examination of the individuals, but molecular diagnostics tools can be applied thanks to the fact that host and cancer cells have different genomes. Indeed, several qPCR have been developed to diagnose MtrBTN [6, 9, 10], a cancer transmissible cell derived from Mytilus trossulus. MtrBTN is a specific BTN infecting various Mytilus species, including M. chilensis. However, if the DN is not a previously described BTN or a conventional cancer, the diagnostics can only be performed by cytology of hemocytes or by histology [3], which requires an expert eye to correctly classify the animals as healthy or diseased, while also been a time-consuming process that must be perform one animal at the time. Therefore, to define molecular markers for a rapid diagnostic is crucial for large-scale testing of mollusks. In Mya arenaria, we have cloned and characterized a retrotransposon named Steamer. Steamer mRNA levels and gene copy number correlates with disease status and can be used as a marker of the disease [11]. Although several Steamer-like elements (SLEs) have been identified in other mollusks [12,13,14], the only mollusk in which a retrotransposon expression and copy number relate to DN is M. arenaria.

Natural populations of the smooth-shelled Chilean blue mussel, Mytilus chilensis (Hupé, 1854), are distributed across a wide range along the South American coast [15]. Moreover, it is extensively cultivated, primarily in Southern Chile, with an annual production exceeding 400,000 tons [16]. This makes it a significant resource for global blue mussel production, with around 17% of world production in Chile [17, 18]. However, mussel aquaculture production in Chile is threatened by several microorganisms [19,20,21], marine pollution [22], the climate variability [23,24,25] and disseminated neoplasia [26, 27] that can impact the larval settlement and growth of mussel populations. Since farmed mussels are collected from the wild at their juvenile stage, seed production can be reduced by all those factors. Therefore, the diagnostic of diseases that threaten both the native population and the farmed individuals is of utmost importance. We wonder if, similar to M. arenaria, M. chilensis have retrotransposons in its genome that could be used as markers of DN. Here we identify putative SLEs retrotransposons and determine if their copies and/or expression are correlated with DN status to potentially be used as markers of disease.

Methods

Disseminated neoplasia diagnostics

200 individuals of optimal commercial size (∽ 6 cm) were collected during June 2018 from two sites in Chile, Castro (42.4801° S, 73.7624° W) and Calbuco (41.7720° S, 73.1327° W). Hemolymph was drawn as in [28], centrifuged at low speed and the hemocytes were stored in RNAlater (Thermo Fisher Scientific) for RNA and DNA extraction. The animals were then opened and the full body with one valve were fixed for a month with 10% formaldehyde in phosphate buffer pH 6.8. After fixation, 5 mm thick transversal section were cut at 5 mm from the posterior adductor muscle, allowing samples of gills and gonads from the specimens. The tissue was paraffin embedded and then sliced in a Sakura Accu-cut rotative microtome, with R35 low profile blades to obtain a 5 μm histological section, that was deparaffined with xylene and dehydrated with ascendent alcohols. Tissue sections were stained with hematoxylin-eosin and mounted with Entellan mounting medium. The visual analysis of each slide was performed in Olympus CX21LED microscope, along with photographic register using a Nikon 808PureView camera cell phone.

For the diagnosis of the specimens, slides were first pre-screened for the presence of hemocyte infiltration. Then a detailed analysis for selected slides was performed. We observe the hemocyte nuclei characteristics, in search of anomalies as salt and pepper chromatin, size augmentation, irregular nuclear edges and degree of infiltration in gonads and gills tissue was performed. For those animals with infiltration, but no obvious alteration in the hemocytes characteristics, nucleus size was measured in five different field, and use as criteria for final classification. Some of these samples were previously used in the Yonemitsu, 2019 [6] named there Calbuco2, Castro 5, 26, 49, 52 and 84.

Mytilus chilensis transcriptome interrogation and in silico analysis

To identify Steamer-like sequences in M. chilensis transcriptome, a BlastN search was conducted using as input M. arenaria retrotransposon Steamer (KF319019.1) and a transcriptome with the following parameters: E-Value 10− 3, word size = 11, Gap cost = Existence 5, Extension 2. The assembly used is deposited into the Sequence Read Archive (SRA) available on the NCBI database, under accession numbers SRX1850489, SRX1850488, SRX1850379, and SRX1847267.

The hits of the transcriptome interrogation (and SLEs identified) were analyzed using Open Reading Frame Finder at National Center for Biotechnology Information (NCBI) [29]. The protein domain search was performed using both Conserved Domain Search Service (CD Search) at NCBI [30] and PROSITE [31]. BlastN was performed against the public sequences of Mytilus edulis, Mytilus galloprovincialis, and Mytilus coruscus found at NCBI. Clustal Omega [32] was used to MchSLEs with a previously described SLE in M trosulus (KX018543.1).

Conventional PCR

For genomic DNA extraction, adductor muscle and mantle of 7 fresh commercially available animals were macerated and digested with 0.1 mg/mL of proteinase K in digestion buffer (100 mM NaCl, 10 mM Tris pH 8.0, 25 mM EDTA, and 0.5% SDS) at 37 °C overnight, after which phenol-chloroform extraction and DNA precipitation were performed. The DNA was resuspended in buffer TE (pH 8.0) and stored at 4 °C. PCR primers were designed to amplify a segment of the reverse transcriptase (RT) domain of Mytilus chilensis Steamer-like element 1 (MchSLE1) [SLE1-F (5´cagacgagagcgatagcgaa3´), SLE1-R (5´gcagtcgcaccgctatctaa3´)], or MchSLE2 [SLE2-F (5´tggcgaaggcgatacagaag3´), SLE2-R 5´cgaagtggctcgcaaatgtc3´)]. Primers for α-tubulin (Tub-F 5´gagccgtctgcatgttgagc3´, Tub-R 5´tggacgaaagcacgtttggc3´), a previously described housekeeping gene for M. chilensis [33] were used. One hundred ng of gDNA from each animal was used in the PCR assay with GoTaq Flexi G2 (Promega), 2 mM MgCl2, 0.5 mM dNTPs, 0.25 µM each primer with a program of 95ºC, 2 min; 35×[95ºC, 30 s; 60ºC, 30 s; 72ºC, 15 s] and a final extension at 72ºC, 5 min. PCR products were visualized on an agarose gel.

Genome walking

Genome walking to obtain the full sequence of the putative SLEs was performed with DNA isolated from one of the seven animals used in conventional PCR, with the Genome Walker Universal kit (Clontech) according to manufacturer’s instructions. The primers 5′GW-SLE1 (5′gcaagtaagcaatgttgcagtacgtag3′) and 5′GW-SLE1nested (5′gatgcgatttcataattgtcccatgtc3′) were designed for a specific 5′ walk of MchSLE1. For the 3′ genome walk, the primers 3′GW-SLE1 (5′aaatggacgtaccgtaagacgtaacag3′) and 3′GW-SLE1nested (5′cctaaacattcagtcgtgcccgatgttg3′) were designed. The primers 5′GW-SLE2 (5′ccgaagtttgtctggttttacgacag3′) and 5′GW-SLE2nested (5′aacccacggagttggcgttgaaactgg3′) were designed for a specific 5′ walk of MchSLE2. For the 3′ genome walk MchSLE2, the primers 3′GW-SLE2 (5′gccacttcatgctgcaccaaagcgttt3′) and 3′GW-SLE2nested (5′tgcaccaaagcgtttacaacgtatgc3′) were designed. All PCR products were cloned and sequenced.

SLEs expression and copy number analysis

The hemocytes isolated in RNAlater were collected by centrifugation, RNA and DNA were isolated using TRIzol Reagent (Thermo Fisher Scientific) according to manufacturer´s instructions. cDNA was synthesized using iScript Reverse transcription Supermix for RT-qPCR (Bio-Rad) and 500 ng of RNA. One µl of cDNA was used in the qPCR assay. For genomic DNA the concentrations among samples varied from 2.5 to 470 ng/µl, and up to 100 ng were used in the qPCR assay. The qPCR assay for cDNA and genomic DNA was performed in triplicate for each sample using the α-tubulin, MchSLE1 and MchSLE2 primers described for conventional PCR and the Brilliant II SYBR green qPCR master mix (Agilent technologies) with the normal two step program (15 min, 95 °C; 40 x [10 s, 95 °C; 30 Sect. 60 °C]), with melting curve (1 min, 95 °C; ramp down to 55 °C, ramp up from 55 °C to 95 °C with continued fluorescence collection). The transcript levels and copy number of MchSLEs and α-tubulin was determined using the standard curve method. A plasmid containing a full-length copy of the PCR fragment cloned from a healthy animal of MchSLE1 or MchSLE2 and α-tubulin was used to generate the standard curve. Standard curves based on serial dilutions of the plasmid were created for each qPCR plate and used to calculate the amount of SLE and tubulin. The ratio of SLE and tubulin for each sample were referred to as relative copy number.

From the 200 samples of hemocytes RNA was extracted, 6 had really low amplification, even of the housekeeping gene, thus they were eliminated from the analysis. In the copy number assay, 11 samples did not yield a product in any of the analyzed genes, thus they were excluded from the whole analysis. In 25 of the samples, including two DN, it was not possible to detect MchSLE2, thus they were not considered in the analysis of MchSLE2. Therefore, the analysis only included 194 animals for the RT-qPCR assays, and 175 samples for the copy number detection of MchSLE2.

BrdU treatment of cultured hemocytes

The in vitro culture of M. chilensis hemocytes was perform as reported in [28] with the following modifications: cells isolated from 24 healthy commercial animals were seeded in 24 well plates at a density of 1.5 × 104 cells per well, in triplicate, 24 h later they were treated with 100 mM BrdU for 24 and 48 h or DMSO (vehicle) for 48 h. RNA was extracted using TRIzol Reagent (Thermo Fisher Scientific) according to manufacturer’s instruction and MchSLE1, MchSLE2 and α-tubulin transcripts were detected as described above. For each set of hemocytes, the vehicle treatment was considered as the basal level of expression and arbitrarily set to 1.

Statistical analysis

All statistical analyses were performed in GraphPad Prism using unpaired t-test 95% confidence or one way ANOVA, a p < 0.05 was considered significant. For the BrdU treatment outliers were eliminated before the statistical analysis.

Results

Diagnostics of disseminated neoplasia in Mytilus chilensis

Histological analysis was used to diagnose the animals, and samples were considered as positive for DN when hemocyte infiltration, loss of tissue architecture and hemocytes abnormalities were observed (Fig. 1). From our observation 183 animals were considered healthy and 14 as DN (10 in Calbuco, 4 in Castro), three animals from Castro were lost during the histological process. Therefore, from the final 197 animals that could be diagnosed, we established a DN prevalence of 10% in Calbuco and 4.1% in Castro, and a total prevalence of 7.1%, similar to what was reported on a previous study from animals collected in 2016 [26].

Fig. 1
figure 1

Disseminated neoplasia in Mytilus chilensis. To determine if MchSLEs are correlated with the presence of disseminated neoplasia in M. chilensis, individuals from 2 different farm sites were diagnosed. Animal were fixed and sliced before hematoxylin-eosin staining. The diagnostic considered level of hemocyte infiltration in the tissue, morphological characteristics, and nuclear size of infiltrating cells. Representative image of female gonad and gills of a normal and a disease animal are shown. A zoom of the area depicted by the withe square is also shwon. Withe arrow heads indicate normal circulating cells, while black arrows indicate cancer cells. DN: disseminated neoplasia. Size bar = 20 μm

Full size image

Our main question was to know if M. chilensis contained in its genome retrotransposons similar to Steamer [12, 13] and test if they correlated with DN as Steamer does [11]. Thus, we saved hemocytes from the diagnosed animals before fix them and in parallel interrogate a transcriptome of M. chilensis.

Identification of steamer-like retrotransposon

A raw transcriptome of M. chilensis available at NCBI was interrogated using Mya arenaria Steamer sequence (KF319019), contigs 5668 (4545 nucleotides) and 21,448 (1158 nucleotides) were selected since both had 64% nucleotide identity to M. arenaria Steamer, and upon in silico translation both contained proteins with domains of the retroviral Pol protein. They were named M. chilensis Steamer-Like Element 1 (MchSLE1) and MchSLE2, respectively (Fig. 2A). MchSLE1 contains a complete open reading frame of 1376 amino acids, with an AUG codon in a Kozak context and a stop codon. MchSLE2 on the other hand, contained a smaller ORF of 385 amino acids, with no obvious initiation or stop codon.

Fig. 2
figure 2

Identification of two Steamer-like elements in Mytilus chilensis. (A) We interrogate the transcriptome of M. chilensis using Mya arenaria Steamer retrotransposon, two contig were found and were named M. chilensis Steamer-like elements (MchSLE) 1 and 2. Both MchSLEs encode proteins with characteristics of retrotransposons. Genome walking was performed to determine if MchSLEs were indeed LTR-retrotransposons. We identified the full sequence of MchSLE1 and partially extended MchSLE2 up to an integrase domain. MchSLE1 is a 4758 bp LTR-retrotransposons with a single ORF of 4134 bp, long terminal repeats (LTRs) of 185 bp, a putative primer binding site (PBS) for the AsnAACtRNA and a Poly purine track (PPT). (B) PCR detection of MchSLE1 (upper panel) and MchSLE2 (middle panel) in the genome of 7 animals, α-Tubulin detection was used as a loading control (bottom panel). The location of the primers used for the PCR assay are depicted above and below the RT domains of both MchSLEs

Full size image

To corroborate if these putative retrotransposons were present in the genome of M. chilensis, we obtained animals at the food market, isolated genomic DNA and amplified both, MchSLE1 and MchSLE2 by PCR from each individual. Both putative retrotransposons were detected in the genome of the seven analyzed animals (Fig. 2B).

At the time of this study the genome of M. chilensis was not available, therefore we decided to perform genome walking using DNA from commercial healthy animals to extend the sequence of both MchSLEs as we did before for Steamer identification [11]. MchSLE1 contains a single ORF of 4134 bp, flanked by 185 pb direct repeats or LTR (Fig. 2A). The single ORF encode a polyprotein of 1376 amino acids were the most highly conserved corresponds to the retroviral Pol regions, including similarities with the retroviral protease with a DSG active site motif [34]; an RT with a polymerase domain containing an YxDD box [35], RNAse H domain with a diagnostic DEDD catalytic core [36] and an integrase with a HHCC zinc finger and a conserved D, D [35]E motif [37] (Fig. 2A). In the amino terminal of the polyprotein the only Gag similarity is a nucleocapsid domain with two putative zinc fingers containing CCCC and CCHC motif. MchSLE1 contains a putative primer binding site (PBS) for the Asn(AAC) tRNA and a Poly-purine track (PPT) sequence (TGAAAAAAGAAAGGA) located at position 4559. For MchSLE1 genome walking analysis showed us that is indeed a LTR-retrotransposon with a full-length sequence of 4758 bp (OR712106), and strongly suggests that the sequence initially identified in the transcriptome corresponds to the full-length RNA genome of MchSLE1, including the 5´and 3´untranslated regions. MchSLE1 was used later to interrogate the genome of M. chilensis and we found 5 copies of this LTR-retrotrasposon distributed in five chromosomes, this was published on [38].

For MchSLE2 we extended the sequence to find a longer ORF encoding protease, RT, RnaseH domains (Fig. 2A) but were not able to find a unique extended sequence further in the 5´or 3´, which suggest this could be the core region of a highly variable mobile element in the genome of M. chilensis (OR712107).

Expression of steamer-like retrotransposon in M. Chilensis hemocytes

We have previously shown that Steamer transcripts as well as copy number are correlated with disease status in M. arenaria (low in healthy versus high in DN) [11], and Steamer presence can be used as a marker of the disease. Thus, we wondered if MchSLEs were correlated with disease status and potentially be used as a marker of the disease in live animals. To test for expression of MchSLEs RNA transcripts and their copy number, RNA and DNA were extracted from circulating cells of normal and DN individuals and the levels of MchSLE1 and MchSLE2 RNA were determined by quantitative PCR (RT-qPCR) and normalized to a α-tubulin as housekeeping RNA [33].

The expression of both MchSLEs was low (compared to tubulin) in normal and DN circulating cells, with no significant differences among them (Fig. 3A and B). Following the same pattern, low relative copy number of MchSLE1 and MchSLE2 were observed among normal and DN animals, and no significant difference was observed between both groups (Fig. 3C and D). These results show that, unlike Steamer, MchSLE1 and MchSLE2 are neither highly expressed, nor expanded in the genome of DN animals, and therefore they cannot be proposed as a molecular marker of the disease.

Fig. 3
figure 3

Steamer-like elements present on M. chilensis are not correlated with disseminated neoplasia. The expression (A and B) and copy number (C and D) of MchSLE1 (A and C) and MchSLE2 (B and D) in hemocytes was determined by qPCR. The analysis was performed using the standard curve method, with a plasmid containing one copy of each MchSLE and MchαTubulin amplicon. The expression and copy were normalized to αTubulin. A t-test was performed, and non-significant differences were found among normal and DN animals. Note that Y axis are not on the same scale. The black line indicates the average expression of the animal set

Full size image

MtrBTN2 is a cancer transmissible cell derived from Mytilus trossulus, that has been previously identified in two of the DN collected samples from this study [6], we therefore compared MchSLEs with an SLE previously described in M. trossulus (KX018543.1) and found a nucleotide identity of only a 52.16% and 51.08% for MchSLE1 and 2 respectively (supplementary data 1). Although we did not verify the presence of MtrBTN2 in all the samples diagnosed as affected by DN histology, the facts that the genome of M. chilensis showed a single copy of MchSLE1 in five different chromosomes [38], that both MchSLEs can be detected in healthy animal, the high identity with sequences found in the genome of other Mytilus, and the fact that no M. trossulus genomic or transcriptomic sequence show a hit on our BlastN assays, indicate that MchSLEs do not derive from MtrBTN2, and agrees with the fact that we did not found correlation between copy number and disease status.

In vitro induction of MchSLEs

Although our results indicate that there is no correlation between expression of MchSLE1 and 2 and DN, there is still expression of these retrotransposons at different levels between individuals. We wondered if as other retrotransposon and endogenous retroviruses, whose transcription is repressed by different epigenetic mechanisms [39, 40] and activated under several stressors [41], MchSLEs transcription could be activated. Bromodeoxiuridine (BrdU) has been shown to be a potent inducer of retrotransposon and endogenous retrovirus transcription [42,43,44], thus we wondered if in vitro treatment of hemocytes with BrdU could induce or increase the expression of MchSLE1 and MchSLE2. Hemocytes isolated from 24 healthy commercial animals were seeded in 24 well plates and cultured at 10 °C for 24 h, animals were treated with 100 µM BrdU or vehicle, for 24–48 h and the levels of MchSLE1 and MchSLE2 transcripts were analyzed by RT-qPCR. We found that, although for some individuals there is no increase on MchSLE1 expression, the group presents a significantly higher expression at 48 h post-treatment (Fig. 4A), while there are no significant changes in transcription of MchSLE2 (Fig. 4B). This suggests that MchSLE1 transcription can, in some individuals, be induced upon stress as it has been shown for other retrotransposons and for endogenous retroviruses.

Fig. 4
figure 4

Steamer-like element 1 responds to BrdU treatment. After collection, hemocytes of 20 different animals were seeded in 24 well plate in triplicates and cultured at 10 ºC for 24 h. Then, DMSO or 100mM BrdU was added to each well. Cells were lysed with Trizol at 24–48 h and RNA was extracted to determine the levels of MchSLE1, MchSLE2 and αTubulin transcripts by RT-qPCR. A. Relative expression of MchSLE1 upon BrdU treatment. B. Relative expression of MchSLE2 upon BrdU treatment. In both, the sum of three experiments performed independently is presented and the DMSO treatment was arbitrary set to 1 for each animal. Please note that Y axis are not in the same scale. One way ANOVA was performed, ns = non-significant, *=p < 0.05. Error bars = SEM

Full size image

Discussion

Disseminated neoplasia (DN) affects at least 15 species of marine bivalves world-wide [1,2,3], of those in at least eight bivalve species [4,5,6,7,8] including M. chilensis, the disease is also a BTN. The diagnostics of DNs must be performed by direct analysis of hemocytes or the animal tissue [3], requiring an expert eye to correctly classify the animals as healthy or sick. Therefore, to define molecular markers to perform a rapid diagnostic is important to test massively the cultures, especially on farmed mollusks. Here we looked for an LTR-retrotransposon similar to Steamer in the smooth-shelled Chilean blue mussel, M. chilensis (Hupé, 1854), that could be use as molecular marker as Steamer can be used for DN in Mya arenaria [11]. Although we conclude that SLEs present in the Chilean blue mussel M. chilensis are differentially expressed among individuals, SLEs are neither highly expressed, nor expanded in the genome of DN animals. Therefore, they cannot be proposed as a molecular marker of the disease.

Recently, a chromosome level genome assembly of M. chilensis was reported [38]. The chromosomal location of the MchSLE1 reported here was analyzed in that report, showing single copy of the full-length retrotransposon in chromosomes 1, 6, 7, 10 and 11. This confirmed that the LTR-retrotransposon MchSLE1 identify here is present in natural population in at least 5 copies. Interestingly the copies present in chromosomes 7 and 11 present a 12 nucleotides insertion in frame with the ORF, that was not cloned in our genome walking analysis. Thus, we cloned MchSLE1 present in either chromosome 1, 6 or 10 and explained the different sequences obtained flanking the LTR in some of the clones amplified in the Genome Walking libraries (data not shown). Because the primers design for qPCR analysis of MchSLE1 copies and expression align on the RT region, further downstream of the 12 nucleotides insertion described in chromosome 7 and 11, we were unable to differentiate which copies were detected in our assays. It could be interesting for future analysis to perform these assays using primer specify for copies present in chromosomes 1, 6, 10 versus 7 and 11, to determine if both are expressed or activated upon a stressor such as BrdU.

We also interrogated the reference genome with MchSLE2 sequence, to our surprise we did not find it in this reference genome. This could mean that MchSLE2 is not really present in the genome of M. chilensis, which we do not believe to be true, since we have obtained amplification of this sequence from genomic DNA from more than 200 animals along this study. Most likely this can be explained by the fact that MchSLE2 is not present in the full population of this species, we had animals form Calbuco that did not produce amplification of this sequence from genomic DNA and in a prospective analysis of animals not included in this study, collected from Ancud, only 20% of the animals presented MchSLE2, while all amplified MchSLE1 (data not shown). Further studies are needed to confirm this.

By using degenerate primers in conserved positions in the RT-IN region of the pol gene and analysis of the available genomes many SLEs have been identified [12,13,14], showing that in bivalve species susceptible to DN those retroelements were not amplified [12]. M. chilensis was not included on those analysis, therefore it was necessary to test if the MchSLEs found here are amplified in hemocytes derived from DN positive animals. Our results align with the previous reports that shown no amplification of SLEs in DN except for the case of M. arenaria [11]. When expression was analyzed, we observed low levels of basal transcription of MchSLEs compared to the α-tubulin housekeeping (Fig. 3A and B), with high variability among individuals, more interestingly we observed that a stressor like BrdU, can increase the levels of both transcripts in some but not all cells isolated from healthy animals in vitro, and a significant higher expression of MchSLE1 is observed at 48 h post BrdU treatment (Fig. 4A). This strongly suggest that at least in M. chilensis, LTR retrotransposons expression are responding to environmental stressors. It could be interesting to test if MchSLE1 can respond to natural stressors or harmful substances that can affect natural banks of mollusks. It remains to be tested if this increase in expression involves retrotransposition of MchSLE1, which could lead to genomic instability and oncogenic changes [45, 46], or if leads to adaptation without increasing the copy number. In many bivalve’s species there has been multiple and frequent cross-species transference of SLE elements [13]. When comparing the full length MchSLE1 and Steamer DNA sequences we found a 66.21% of nucleotide identity. We also performed BlastN analysis of MchSLE1 against sequences from other Mytilus available at NCBI and founded ten sequences with 100% coverage and 95-99.5% of nucleotide identity derived from Mytilus edulis, Mytilus galloprovincialis, and Mytilus coruscus in agreement to our previous report [38] (Supplementary data 2). MchSLE1could also have been transmitted among those Mytilus as reported for other bivalves [13] or could be shared between them from a common ancestor reflecting the complex evolutionary history these bivalves.

The transcriptome analysis and specific strand RT-PCR analysis showed transcripts derived from both strand of MchSLE1 [47], suggesting that both LTRs cand be acting as promoters, our analysis cannot differentiate from which MchSLE1 strand the detected transcripts are being generated, but it will be interesting to test if in any given individual are both transcribed or if they transcribed preferentially. We can speculate that as it has been suggested for retroviruses (Revised in [48, 49]) and Long interspersed nuclear element-1 (LINE-1) [50] the antisense transcripts can be regulators of the sense mRNA, helping to control the expression of the LTR-retrotransposon. Further experiments will be needed to determine if this is indeed happening and if the antisense transcripts or the putative peptides they encode have and any influence on MchSLE1 expression.

Bivalve transmissible neoplasia has been previously shown to affect M. chilensis from Argentina and Chile, where MtrBTN2 lineage (derived from M. trossulus), has been previously identify in two DN samples from this study (out of four analyzed DNA isolated from circulation cells) [6]. So far only one SLE has been reported in M. trossulus (KX018543.1), but only has 52.16% and 51.08% nucleotide identity with for MchSLE1 and 2 respectively. It would be important for future prospections for DN to look also for MtrBTN2 and these SLEs or others that can be identify as specific of M. trossulus, their possible amplification could be used as a marker of the disease.

The impact of DN on mollusk aquaculture and its connection to climate change has not been fully assessed thus far. We are aware that climate change not only directly affects marine environments but can also indirectly contribute to the emergence of additional stressors in ecosystems, including infectious diseases like disseminated neoplasia [51]. Therefore, there is a pressing need to develop efficient diagnostic tools for DN to detect and prevent harmful outbreaks of this disease.

Conclusions

We conclude that SLEs present in Mytilus chilensis are differentially expressed among individuals and do not correlate with disseminated neoplasia. Treatment of hemocytes with a stressor like bromodeoxyuridine induces expression MchSLE1 suggesting that in Mytilus chilensis environmental stressors can induce activation of LTR-retrotransposon.

Data availability

The data that support the findings of this study are available from the corresponding author upon request.

Abbreviations

DN:

disseminated neoplasia

BTN:

Bivalve transmissible neoplasia

BrdU:

5-Bromo-2´-deoxiuridine

SLE:

Steamer-like element

ORF:

open reading frame

LTR:

long terminal repeat

PBS:

Primer binding site

PPT:

Poly purine track

References

  1. Barber BJ. Neoplastic diseases of commercially important marine bivalves. Aquat Living Resour. 2004;17(04):449–66.

    Article  Google Scholar 

  2. Elston RA, Moore JD, Brooks K. Disseminated neoplasia of bivalve molluscs. Rev Aquat Sci. 1992;6:405–66.

    Google Scholar 

  3. Carballal MJ, Barber BJ, Iglesias D, Villalba A. Neoplastic diseases of marine bivalves. J Invertebr Pathol. 2015;131:83–106.

    Article  PubMed  Google Scholar 

  4. Metzger MJ, Reinisch C, Sherry J, Goff SP. Horizontal transmission of clonal cancer cells causes leukemia in soft-shell clams. Cell. 2015;161(2):255–63.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  5. Metzger MJ, Villalba A, Carballal MJ, Iglesias D, Sherry J, Reinisch C, et al. Widespread transmission of independent cancer lineages within multiple bivalve species. Nature. 2016;534(7609):705–9.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  6. Yonemitsu MA, Giersch RM, Polo-Prieto M, Hammel M, Simon A, Cremonte F et al. A single clonal lineage of transmissible cancer identified in two marine mussel species in South America and Europe. Elife. 2019;8.

  7. Garcia-Souto D, Bruzos AL, Diaz S, Rocha S, Pequeno-Valtierra A, Roman-Lewis CF et al. Mitochondrial genome sequencing of marine leukaemias reveals cancer contagion between clam species in the seas of Southern Europe. Elife. 2022;11.

  8. Michnowska A, Hart SFM, Smolarz K, Hallmann A, Metzger MJ. Horizontal transmission of disseminated neoplasia in the widespread clam Macoma balthica from the Southern Baltic Sea. Mol Ecol. 2022;31(11):3128–36.

    Article  PubMed  PubMed Central  Google Scholar 

  9. Burioli EAV, Hammel M, Bierne N, Thomas F, Houssin M, Destoumieux-Garzón D, et al. Traits of a mussel transmissible cancer are reminiscent of a parasitic life style. Sci Rep. 2021;11(1):24110.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  10. Hammel M, Simon A, Arbiol C, Villalba A, Burioli EAV, Pépin JF, et al. Prevalence and polymorphism of a mussel transmissible cancer in Europe. Mol Ecol. 2022;31(3):736–51.

    Article  CAS  PubMed  Google Scholar 

  11. Arriagada G, Metzger MJ, Muttray AF, Sherry J, Reinisch C, Street C, et al. Activation of transcription and retrotransposition of a novel retroelement, Steamer, in neoplastic hemocytes of the mollusk Mya arenaria. Proc Natl Acad Sci U S A. 2014;111(39):14175–80.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  12. Paynter AN, Metzger MJ, Sessa JA, Siddall ME. Evidence of horizontal transmission of the cancer-associated Steamer retrotransposon among ecological cohort bivalve species. Dis Aquat Organ. 2017;124(2):165–8.

    Article  PubMed  Google Scholar 

  13. Metzger MJ, Paynter AN, Siddall ME, Goff SP. Horizontal transfer of retrotransposons between bivalves and other aquatic species of multiple phyla. Proc Natl Acad Sci U S A. 2018;115(18):E4227–35.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  14. Farhat S, Bonnivard E, Pales Espinosa E, Tanguy A, Boutet I, Guiglielmoni N, et al. Comparative analysis of the Mercenaria mercenaria genome provides insights into the diversity of transposable elements and immune molecules in bivalve mollusks. BMC Genomics. 2022;23(1):192.

    Article  PubMed  PubMed Central  Google Scholar 

  15. Oyarzún PA, Toro JE, Nuñez JJ, Suárez-Villota EY, Gardner JPA. Blue mussels of the Mytilus edulis species complex from South America: the application of species delimitation models to DNA sequence variation. PLoS ONE. 2021;16(9):e0256961.

    Article  PubMed  PubMed Central  Google Scholar 

  16. Seranapesca. Estadistica pequera del servicio nacional de pesca y acuicultura [ http://www.sernapesca.cl/informacion-utilidad/anuarios-estadisticos-de-pesca-y-acuicultura.

  17. Uriarte I. Estado actual del cultivo de moluscos bivalvos en Chile, FAO Actas de Pesca y Acuicultura. 2008.

  18. Gonzalez-Poblete E, Hurtado CF, Rojo C, Norambuena R. Blue mussel aquaculture in Chile: small or large scale industry? Aquaculture. 2018;493:113–22.

    Article  Google Scholar 

  19. Enriquez R, Frosner GG, Hochsteinmintzel V, Riedemann S, Reinhardt G. Accumulation and Persistence of Hepatitis-a Virus in mussels. J Med Virol. 1992;37(3):174–9.

    Article  CAS  PubMed  Google Scholar 

  20. Gray AP, Lucas IAN, Seed R, Richardson CA. Mytilus edulis chilensis infested with Coccomyxa Parasitica (Chlorococcales, Coccomyxaceae). J Mollus Stud. 1999;65:289–94.

    Article  Google Scholar 

  21. Detree C, Nunez-Acuna G, Roberts S, Gallardo-Escarate C. Uncovering the Complex Transcriptome response of Mytilus chilensis against Saxitoxin: implications of Harmful Algal blooms on Mussel populations. PLoS ONE. 2016;11(10).

  22. Blanc JM, Molinet C, Subiabre R, Diaz PA. Cadmium determination in Chilean blue mussels Mytilus chilensis: implications for environmental and agronomic interest. Mar Pollut Bull. 2018;129(2):913–7.

    Article  CAS  PubMed  Google Scholar 

  23. Vihtakari M, Hendriks IE, Holding J, Renaud PE, Duarte CM, Havenhand JN. Effects of Ocean Acidification and warming on sperm activity and early life stages of the Mediterranean Mussel (Mytilus galloprovincialis). Water-Sui. 2013;5(4):1890–915.

    Google Scholar 

  24. Hüning AKM, Thomsen F, Gutowska J, Krämer MA, Frickenhaus L, Rosenstiel S, Pörtner P, Philipp H-O, Lucassen EE. M. mpacts of seawater acidification on mantle gene expression patterns of the Baltic Sea blue mussel: implications for shell formation and energy metabolism. Mar Biol. 2013;160(8):1845–61.

    Article  Google Scholar 

  25. Harvell CDM, Ward CE, Altizer JR, Dobson S, Ostfeld AP, Samuel RS. Climate warming and disease risks for terrestrial and marine biota. Science. 2002;296(5576):2158–62.

    Article  CAS  PubMed  Google Scholar 

  26. Lohrmann KB, Bustos E, Rojas R, Navarrete F, Robotham H, Bignell J. Histopathological assessment of the health status of Mytilus chilensis (Hupé 1854) in southern Chile. Aquaculture. 2019;503:40–50.

    Article  Google Scholar 

  27. Cremonte F, Vázquez N, Silva MR. Gonad atrophy caused by disseminated neoplasia in Mytilus chilensis cultured in the Beagle Channel, Tierra Del Fuego Province, Argentina. J Shellfish Res. 2011;30(3):845–9.

    Article  Google Scholar 

  28. Astuya A, Carrera C, Ulloa V, Aballay A, Nunez-Acuna G, Hegaret H, et al. Saxitoxin modulates immunological parameters and Gene Transcription in Mytilus chilensis Hemocytes. Int J Mol Sci. 2015;16(7):15235–50.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  29. Sayers EW, Bolton EE, Brister JR, Canese K, Chan J, Comeau DC, et al. Database resources of the national center for biotechnology information. Nucleic Acids Res. 2022;50(D1):D20–6.

    Article  CAS  PubMed  Google Scholar 

  30. Lu S, Wang J, Chitsaz F, Derbyshire MK, Geer RC, Gonzales NR, et al. CDD/SPARCLE: the conserved domain database in 2020. Nucleic Acids Res. 2020;48(D1):D265–8.

    Article  CAS  PubMed  Google Scholar 

  31. Sigrist CJ, de Castro E, Cerutti L, Cuche BA, Hulo N, Bridge A, et al. New and continuing developments at PROSITE. Nucleic Acids Res. 2013;41(Database issue):D344–7.

    CAS  PubMed  Google Scholar 

  32. Larkin MA, Blackshields G, Brown NP, Chenna R, McGettigan PA, McWilliam H, et al. Clustal W and Clustal X version 2.0. Bioinformatics. 2007;23(21):2947–8.

    Article  CAS  PubMed  Google Scholar 

  33. Núñez-Acuña G, Tapia FJ, Haye PA, Gallardo-Escárate C. Gene expression analysis in Mytilus chilensis populations reveals local patterns associated with ocean environmental conditions. J Exp Mar Biol Ecol. 2012;420–421:56–64.

    Article  Google Scholar 

  34. Loeb DD, Hutchison CA 3rd, Edgell MH, Farmerie WG, Swanstrom R. Mutational analysis of human immunodeficiency virus type 1 protease suggests functional homology with aspartic proteinases. J Virol. 1989;63(1):111–21.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  35. Yuki S, Ishimaru S, Inouye S, Saigo K. Identification of genes for reverse transcriptase-like enzymes in two Drosophila retrotransposons, 412 and gypsy; a rapid detection method of reverse transcriptase genes using YXDD box probes. Nucleic Acids Res. 1986;14(7):3017–30.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  36. Hyjek M, Figiel M, Nowotny M, RNases H. Structure and mechanism. DNA Repair. 2019;84:102672.

    Article  CAS  PubMed  Google Scholar 

  37. Kulkosky J, Jones KS, Katz RA, Mack JP, Skalka AM. Residues critical for retroviral integrative recombination in a region that is highly conserved among retroviral/retrotransposon integrases and bacterial insertion sequence transposases. Mol Cell Biol. 1992;12(5):2331–8.

    CAS  PubMed  PubMed Central  Google Scholar 

  38. Gallardo-Escarate C, Valenzuela-Munoz V, Nunez-Acuna G, Valenzuela-Miranda D, Tapia FJ, Yevenes M, et al. Chromosome-Level Genome Assembly of the Blue Mussel Mytilus chilensis reveals molecular signatures facing the Marine Environment. Genes (Basel). 2023;14(4):876.

    Article  CAS  PubMed  Google Scholar 

  39. Zhang Q, Pan J, Cong Y, Mao J. Transcriptional regulation of endogenous retroviruses and their Misregulation in Human diseases. Int J Mol Sci. 2022;23(17).

  40. Geis FK, Goff SP. Silencing and transcriptional regulation of endogenous retroviruses: an overview. Viruses. 2020;12(8).

  41. Yoshikura H, Zajdela F, Perin F, Perin-Roussel O, Jacquignon P, Latarjet R. Enhancement of 5-iododeoxyuridine-induced endogenous C-type virus activation by polycyclic hydrocarbons: apparent lack of parallelism between enhancement and carcinogenicity. J Natl Cancer Inst. 1977;58(4):1035–40.

    Article  CAS  PubMed  Google Scholar 

  42. Oprandy JJ, Chang PW. 5-bromodeoxyuridine induction of hematopoietic neoplasia and retrovirus activation in the soft-shell clam, Mya arenaria. J Invertebr Pathol. 1983;42(2):196–206.

    Article  CAS  PubMed  Google Scholar 

  43. Moroni C, Matter A, Stoye JP, Monckton RP, Delamarter JF, Schumann G. Concanavalin A promotes bromodeoxyuridine induction of enodgenous C-Type virus in B cells. Cell Immunol. 1980;54(1):107–14.

    Article  CAS  PubMed  Google Scholar 

  44. Lerner-Tung MB, Doong SL, Cheng YC, Hsiung GD. Characterization of conditions for the activation of endogenous guinea pig retrovirus in cultured cells by 5-bromo-2’-deoxyuridine. Virus Genes. 1995;9(3):201–9.

    Article  CAS  PubMed  Google Scholar 

  45. Kemp JR, Longworth MS. Crossing the LINE toward genomic instability: LINE-1 retrotransposition in Cancer. Front Chem. 2015;3:68.

    Article  PubMed  PubMed Central  Google Scholar 

  46. Shukla R, Upton KR, Munoz-Lopez M, Gerhardt DJ, Fisher ME, Nguyen T, et al. Endogenous retrotransposition activates oncogenic pathways in hepatocellular carcinoma. Cell. 2013;153(1):101–11.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  47. Fernández-García L, Ahumada-Marchant C, Lobos-Ávila P, Brauer B, Bustos FJ, Arriagada G. The Mytilus chilensis steamer-like Element-1 retrotransposon antisense mRNA harbors an internal ribosome entry site that is modulated by hnRNPK. Viruses. 2024;16(3):403.

    Article  PubMed  PubMed Central  Google Scholar 

  48. Romerio F. Origin and functional role of antisense transcription in endogenous and exogenous retroviruses. Retrovirology. 2023;20(1):6.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  49. Lin E, Panfil AR, Sandel G, Jain P. Novel perspectives on antisense transcription in HIV-1, HTLV-1, and HTLV-2. Front Microbiol. 2022;13:1042761.

    Article  PubMed  PubMed Central  Google Scholar 

  50. Denli AM, Narvaiza I, Kerman BE, Pena M, Benner C, Marchetto MC, et al. Primate-specific ORF0 contributes to retrotransposon-mediated diversity. Cell. 2015;163(3):583–93.

    Article  CAS  PubMed  Google Scholar 

  51. Bramwell G, Schultz AG, Sherman CDH, Giraudeau M, Thomas F, Ujvari B, et al. A review of the potential effects of climate change on disseminated neoplasia with an emphasis on efficient detection in marine bivalve populations. Sci Total Environ. 2021;775:145134.

    Article  CAS  Google Scholar 

Download references

Acknowledgements

Not applicable.

Funding

GA was funded by ANID/FONDECYT Regular 1180705 and ANID/FONDECYT Regular 1220480. GA and PAO were funded by DGI UNAB DI-06-23/OS. CG-E was funded by ANID/FONDECYT Regular 1210852. JAV and CGE were funded by ANID/(FONDAP 1522A0004). The funding bodies had no role in the design of the study and collection, analysis, and interpretation of data, or in writing the manuscript.

Author information

Authors and Affiliations

  1. Instituto de Ciencias Biomédicas, Facultad de Medicina y Facultad de Ciencias de la Vida, Universidad Andres Bello, Santiago, Chile

    Gloria Arriagada, Johan Quezada, Nicolas Merino-Veliz, Fernando Avilés, Diana Tapia-Cammas, Jorge Gomez & Daniela Curotto

  2. Departamento de Ciencias Biológicas, Facultad de Ciencias de la Vida, Universidad Andres Bello, Santiago, Chile

    Juan A. Valdes & Marco Alvarez

  3. Interdisciplinary Center for Aquaculture Research (INCAR), University of Concepción, Concepción, Chile

    Juan A. Valdes & Cristian Gallardo-Escárate

  4. Centro de Investigación Marina Quintay (CIMARQ), Universidad Andres Bello, Quintay, Chile

    Pablo A. Oyarzún

  5. Pacific Northwest Research Institute, Seattle, USA

    Michael J. Metzger

Authors
  1. Gloria Arriagada
    View author publications

    You can also search for this author in PubMed Google Scholar

  2. Johan Quezada
    View author publications

    You can also search for this author in PubMed Google Scholar

  3. Nicolas Merino-Veliz
    View author publications

    You can also search for this author in PubMed Google Scholar

  4. Fernando Avilés
    View author publications

    You can also search for this author in PubMed Google Scholar

  5. Diana Tapia-Cammas
    View author publications

    You can also search for this author in PubMed Google Scholar

  6. Jorge Gomez
    View author publications

    You can also search for this author in PubMed Google Scholar

  7. Daniela Curotto
    View author publications

    You can also search for this author in PubMed Google Scholar

  8. Juan A. Valdes
    View author publications

    You can also search for this author in PubMed Google Scholar

  9. Pablo A. Oyarzún
    View author publications

    You can also search for this author in PubMed Google Scholar

  10. Cristian Gallardo-Escárate
    View author publications

    You can also search for this author in PubMed Google Scholar

  11. Michael J. Metzger
    View author publications

    You can also search for this author in PubMed Google Scholar

  12. Marco Alvarez
    View author publications

    You can also search for this author in PubMed Google Scholar

Contributions

GA and MA design the study. GA, JQ, NM-V, FA, DT-C, JG, and DC performed experiments and analyzed data. JAV performed the transcriptome analysis. GA, PAO, CG-E, MJM and MA analyzed data and discuss the results and its implications. GA, PAO and CG-E secure funding. GA wrote the manuscript, all authors read it and made contributions.

Corresponding author

Correspondence to Gloria Arriagada.

Ethics declarations

Ethics approval and consent to participate

Not applicable.

Consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

Additional information

Publisher’s Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Electronic supplementary material

Below is the link to the electronic supplementary material.

Supplementary Material 1

Supplementary Material 2

Rights and permissions

Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated in a credit line to the data.

Reprints and permissions

About this article

Check for updates. Verify currency and authenticity via CrossMark

Cite this article

Arriagada, G., Quezada, J., Merino-Veliz, N. et al. Identification and expression analysis of two steamer-like retrotransposons in the Chilean blue mussel (Mytilus chilensis). Biol Res 57, 17 (2024). https://doi.org/10.1186/s40659-024-00498-x

Download citation

  • Received:

  • Accepted:

  • Published:

  • DOI: https://doi.org/10.1186/s40659-024-00498-x

Keywords

Biological Research

ISSN: 0717-6287

Contact us