Skip to main content

Table 1 The details of primers sequence and the annealing temperature

From: Overexpression of bHLH domain of HIF-1 failed to inhibit the HIF-1 transcriptional activity in hypoxia

Primer Sequence (forward, reverse) Annealing temperature
HPRT1 F: AATTACTTTTATGTCCCCTGTTGACTGG
R: GCTATAAATTCTTTGCTGACCTGCTG
63
VEGF F: TTGCCTTGCTGCTCTACCTCCA
R: GATGGCAGTAGCTGCGCTGATA
62.5
HIF-1a F: TGAGTTCGCATCTTGATAAGGC
R: ACAAAACCATCCAAGGCTTTCA
63
N-cadherin F: GGACAGTTCCTGAGGGATCA
R: GGATTGCCTTCCATGTCTGT
62.5
Vimentin F: GGTGGACCAGCTAACCAACGA
R: TCAAGGTCAAGACGTGCCAGA
62.5
β-catenin F: AAAATGGCAGTGCGTTTAG
R: TTTGAAGGCAGTCTGTCGTA
62