Skip to main content

Table 1 Sequences of primers used for quantitative real-time PCR assays

From: CXCL8(3–72) K11R/G31P protects against sepsis-induced acute kidney injury via NF-κB and JAK2/STAT3 pathway

Genename Forward (5′–3′) Reverse (5′–3′)
IL-1β TGCCACCTTTTGACAGTGATGAG TGATGTGCTGCTGCGAGATTT
IL-6 AGGATACCACTCCCAACAGACC GCACAACTCTTTTCTCATTTCCAC
TNF-α ACTCCAGGCGGTGCCTATG GTGAGGGTCTGGGCCATAGAA
GAPDH GCCTTCCGTGTTCCTACCC CAGTGGGCCCTCAGATGC
\