Skip to main content

Table 1 Nucleotide sequences of primer pairs used for real-time qPCR

From: Morphological, molecular and FTIR spectroscopic analysis during the differentiation of kidney cells from pluripotent stem cells

Gen Forward 5′–3′ Reverse 5–3
β-actin AGAGGGAAATCGTGCGTGAC AACCGCTCGTTGCCAATAGT
Oct4 ACATGTGTAAGCTGCGGCC TCCAGACTCCACCTCACACG
SOX2 AACCGATGCACCGCTACG TTGACCACAGAGCCCATGG
PAX2 CGCTCCAACGGTGAGAAGAG AGACTCGATCCAGAGCTTCCAG
WT1 GCATCCCAGGCAGGAAAGT TCCTTCCGGCAAACCTGATA
Ksp ACCCAACAGTCAACATCCCTG GCTTTGTTTTCAGCCCCCTC
\