Skip to main content

Table 2 BLASTX v2.3.1 results of differentially expressed genes between adult and juvenile samples

From: De novo transcriptome assembly, functional annotation and differential gene expression analysis of juvenile and adult E. fetida, a model oligochaete used in ecotoxicological studies

Gene ID P value and FDR Sequence BLASTX
TRINITY_DN212688_c0_g3_i1 5.70E−09
0.000322
CCTCAGTATGAGGATCCTCGTGCTTGATGGCCAACTTGTGCAATTCCAGCAAAGCCTCGTTAAGGCTCTTCTCCATATCCAGAGATGTCTGCATTGCTCCCAATGCGGTTCCCCAGGAGTCAACAGCCGGTTTCGAGACGTCGTCAAGAACAACGCAACCGCCACGCTTGTTCATGTACTTCATCATGTCACCAGCATGGCTTCTCTCTTCCTTTGAGTTTTCACTGAAGAACTTCGATAAGCTAGGCAGAGCCACTGAGTCATTATCAAAGTAGATCGCCATCGAATGAAAGTTGTAGGAAGCCTCAAGCTCCAGATTGATCTGCTTGTTCAGACACTTCTCAACCTCGACATGGAAGTTCTGACGAATCTGCGAGTCAGACAAAGATTC Ferritin (Eisenia andrei)
TRINITY_DN228981_c22_g3_i1 1.15E−08
0.000322
TTTATCGTCTTTTTACTTATTCGCTGAAGCGGAGCTGGGTTTAACGACCCACCTTTTGGCTTTAAGGTCCTATACGGGCTGATCCGGGTTGAAGACATTGTCAGGTGGGGAGTTTGGCTGGGGCGGCACATCTGTTAAACCATAACGCAGGTGTCCTAAGGGGGACTCATGGAGAACAGAAATCTCCAGTAGAGCAAAAGGGCAAAAGTCCCCTTGATTTTGATTTTCAGTGTGAATACAAACCATGAAAG Senescence associated protein (Cennococcum geophilum)
TRINITY_DN211598_c1_g4_i1 1.49E−08
0.000322
AGGTAAAGTTAACCAATGTAGTGGTGGCTACTGTGGACCGTATAAAATCTCGGAACCTTACTATAAGGACTGCGGAAAGCCAGGAGCCGGCTACCAACGATGTACTAAGCAGAAAGCTTGTTCGGAATTGTGCATCAAGTCTTACATGGAGCGCTACGCCACGAAATGTCCCAGACCTATTACCTGTGAAGACTATGCTCGCGTACACGTAGGAGGACCTGGCGGATGCACGAAGCCTTCAACCG Lysozyme (Eisenia fetida)
TRINITY_DN203900_c3_g1_i1 4.58E−08
0.000741
GAAAATCCTAGGGAACGAATAATTTTCACGCCTGGTCGTACTCATAACCGCAGCAGGTCTCCAAGGTGAACAGCCTCTAGTTGATAGAACAATGTAGATAAGGGAAGTCGGCAAAATAGATCCGTAACTTCGGGATAAGGATTGGCTCTAAGGGTTGGGTGCGTTGGGCCTTGAGCAGAAGCCCTGGGAGCAGGTTGGCACTAGCCTCACGGCCGGCGCCTTCCAGCACCCGGTGGCGGACGCTCTTGGCAGGGTTCGCCCGTCCGGCGCACGCTTAACAACCAACTTAGAACTGGTACGGACAAGGGGAATCTGACTG Hypthetical protein (Tricoderma virens)
TRINITY_DN218384_c10_g9_i1 8.03E−08
0.000948
GTTTCTTTTCCTCCGCTTATTGATATGCTTAAGTTCAGCGGGTATCCCTACCTGATCCGAGGTCAAAAGTGATAAATAATCTTGATGGATGCCAACAAAAATTGGTCTGTCACGCAAATTGTGCTGCGCTTCAAACCATTATATTAGCTGCCAATATATTTAAGGCGAGTCTAGGCTAAGCAAAGACAAACACCCAACACCAAGCAAGGCTTGAGAGTACAAATGACGCTCGAACAGGCATGCCCCCCGGAATACCAGGGGGCGCAATGTGCGTTCAAAGATTCGATGATTCACTGAATTCTGCAATTCACACTACTTATCGCATTTCGCTGCGTTCTTCATCGATGCCAGAACCAAGAGATCCGTTGTTGAAAGTTGTAATTATTAAATTTATTCAGACGCTGATTGAAAATAAAAAGGTTATAGAGTTGTCCAGCCGGCAGGCAAGCCTGCCGAGGAAACATGAGTGCGCAAAAAGTCAGGGGTTAAGAAAAGAGGCGTACTTCTTCTCAAGCAAGGCCCAAGAAGTTTCCGTCTCCCTCAAACAGTAGTAAACTACTGAAATTAATGATCCTTCCGCAGGTTCACCTACGGAAA NADH cytochrome b5 reductase (Aspergillus)
TRINITY_DN13199_c0_g1_i1 8.80E−08
0.000948
CCCCGTTACCCGTTGATACCATGGTAGGCCACTATCCTACCATCGAAAGTTGATAGGGCAGAAATTTGAATGAACCATCGCCGGCGCAAGGCCATGCGATTCGTTAAGTTATTATGATTCACCAAGGAGCCCCGAAGGGCATTGGTTTTTTATCTAATAAATACACCCCTTCCGAAGTCGAGGTTTTTAGCATGTATTAGCTCTAGAATTACCACGGTTATCCAGGTAAAGGTACTATCAAATAAACGATA Hypothetical protein (Capitella teleta)