Skip to main content

Table 1 Primer and probe sequences used in this study

From: Reprimo as a modulator of cell migration and invasion in the MDA-MB-231 breast cancer cell line

ID Sequences (5′–>3′) PCR product (pb) References
RPRM (forward) CTGCGAATTTGAACGGGGTGAGT 137
RPRM (reverse) GCGTAAACCGTGCAGTCACGA 137
RPRM-M (forward) GCGAGTGAGCGTTTAGTTC 120 Sato et al. [8]
RPRM-M (reverse) TACCTAAAACCGAATTCATCG 120 Sato et al. [8]
RPRM-U (forward) TTGTGAGTGAGTGTTTAGTTTG 113 Sato et al. [8]
RPRM-U (reverse) TAATTACCTAAAACCAAATTCATC 113 Sato et al. [8]
B-actin-M (forward) TGGTGATGGAGGAGGTTTAGTAAGT 133 Moon et al. [30]
B-actin-M (reverse) AACCAATAAAACCTACTCCTCCCTTAA 133 Moon et al. [30]
RPRM (probe qMSP) /56-FAM/TT CGC GTC G/ZEN/T TCG CGG CGT TCG TT/3IABkFQ/ 120
B-actin (probe qMSP) /56-FAM/AC CAC CAC C/ZEN/C AAC ACA CAA TAA CAA ACA CA/3IABkFQ/ 133 Moon et al. [30]
  1. M methylated, U unmethylated
\