Skip to main content

Table 2 Small interfering RNA sequences

From: Integrin-β1, not integrin-β5, mediates osteoblastic differentiation and ECM formation promoted by mechanical tensile strain

Description Type Sequence (5′-3′)
ITGβ1 RNA UAGAAAUGUUGGAACACUUUCGUCC
   GGACGAAAGUGUUCCAACAUUUCUA
ITGβ5 RNA UACAGCCGCAUGUGCAAUUGUAGGC
   GCCUACAAUUGCACAUGCGGCUGUA