Skip to main content

Table 8 List of primer pair for PCR amplification

From: Stress tolerant virulent strains of Cronobacter sakazakii from food

Primer Sequence 5' to 3' Targeted site Product size (bp) Reference
Esakf/ GCTYTGCTGACGAGTGGCGGa 16S rDNA 929 [33]
Esakr ATCTCTGCAGGATTCTCTGG
EsgluAf/ TGAAAGCAATCGACAAGAAGb gluA 1680 [34]
EsgluAr ACTCATTACCCCTCCTGATG
Saka 1a/ ACAGGGAGCAGCTTGCTGCc V1g 952 [14]
Saka 2b TCCCGCATCTCTGCAGGA V3h
ESSF/ GGATTTAACCGTGAACTTTTCCd ompA 469 [35]
ESSR CGCCAGCGATGTTAGAAGA
Zpx F/ GAAAGCGTATAAGCGCGATTCe zpx 94 [27]
Zpx R GTTCCAGAAGGCGTTCTGGT
  1. a&cRunning conditions; 94°C for 5 min; 35 cycles of 94°C for 1 min each; 60°C for 1 min; 72°C for 1.5 min; a final extension period of 5 min at 72°C.
  2. bRunning conditions; 94°C for 10 min; 35 cycles of 94°C for 30 sec each; 60°C for 1 min; 72°C for1.5 min; final extension period of 5 min at 72°C.
  3. dRunning conditions; 94°C for 5 min; 35 cycles of 94°C for 1 min each; 54°C for 45 sec; 72°C for1.5 min; final extension period of 5 min at 72°C.
  4. eRunning conditions; 94°C for 15 min; 35 cycles of 94°C for 1 min each; 58°C for 1 min; 72°C for1.5 min; final extension period of 10 min at 72°C.