Skip to main content

Table 2 List of oligonucleotide primers used in this study

From: Loop-mediated isothermal amplification assays for screening of bacterial integrons

Target Sequence (5’ to 3’) Size (bp) Position GenBank no.
intI1     AF550415
F3 AACAGTCTTGTACAAGTCCA 20 903-922
B3 GGTGCTTTTGATATTTTTCCG 21 1075-1095
FIP CTCTCTTTCCTCTGCGGTCCTTTTGATGTTTTTCACACTTATTGGAT 43 936-958, 976-995
BIP TAAGGAATCACCTTGCAGATAAACTTTTTAGTACATTGGCATCGTGT 43 1000-1024, 1057-1074
LF CCAGAGTTAAGATTGAT 17 959-975
LB CGAAACAAGGCCAGTTTTTTACC 23 1028-1050
intI2     AP002527
F3 TGTTGGAAGAATTTCTTTTGGA 22 726-747
B3 GCTAATAGCCCTGCGTATC 19 924-942
FIP CGCGATGCATGATGATGACAATTTTTAGTGTTAATGCAATTCTGGGT 43 748-768, 788-809
BIP GAGCTTCCTTCTATGTGCCCGTTTTCAGAGTGGATGAGTCCCA 39 832-852, 895-912
LF TCGCACCGTAATTATGACT 19 769-787
LB AGATGGAAGAGTGCGTGGG 19 855-873
intI3     AY219651
F3 TCGGTGTCTGTTATTAACCA 20 175-194
B3 TGGAAACCGTTGTCACAC 18 371-388
FIP AGACGAAGATGGTCAAAACGCTTTTGCAGTTATTTTGCTGTGGA 40 206-224, 252-272
BIP CCGGGTTCGTTAATACGGCATTTTCGGGCACTGATATATGTGT 39 302-321, 352-370
LF TGATAGACATCAAGCCCTCGT 21 228-248
LB CAAATACTTTCTACCGTTTT 20 323-342