Skip to main content

Table 2 Names and primer sequences of genes of interest and relative internal references

From: miR-146a-5p-mediated suppression on trophoblast cell progression and epithelial-mesenchymal transition in preeclampsia

Name of primer Sequences(5′-3′)
miR-146a-5p-F AACCCATGGAATTCAGTTCTCA
miR-146a-5p-R ATCCAGTGCAGGGTCCGAGG
Wnt2-F GGGTCCTACTCCGAAGTAG
Wnt2-R CCTTGGCTACAGGCCCTG
Vimentin-F TCCGCACATTCGAGCAAAGA
Vimentin-R TGAGGGCTCCTAGCGGTTTA
N-cadherin-F AGGGGAGAGGTGCTCTACTG
N-cadherin-R GGGGTAATCCACACCACCTG
E-cadherin-F CGTCGAGCTCTTGACCGAAA
E-cadherin-R TCAAACACCTCCTGTCCTCT
GAPDH-F ACCACAGTCCATGCCATCAC
GAPDH-R TCCACCACCCTGTTGCTGTA
U6-F TCGCTTCGGCAGCACATATAC
U6-R GCGTGTCATCCTTGCGCAG
  1. F forward; R reverse