Skip to main content

Table 4 The primer sequence of circRNAs

From: The role of circular RNA circ_0008285 in gestational diabetes mellitus by regulating the biological functions of trophoblasts

Primer name Sequence (5′-3′)
GAPDH-divergent-F TCCTCACAGTTGCCATGTAGACCC
GAPDH-divergent-R TGCGGGCTCAATTTATAGAAACCGGG
GAPDH-convergent-F GAGTCAACGGATTTGGTCGT
GAPDH-convergent-R GACAAGCTTCCCGTTCTCAG
circ_0008285-divergent-F TCATAGCCTTTCCACCGA
circ_0008285-divergent-R ACAGTGGCACCCGAAGTG
circ_0008285-convergent-F ACCTCTCCTAAGGCACTCGT
circ_0008285-convergent-F GGTCCAGTTTCTCAGGGCTC
circ_0001173-divergent-F GCTGGCAATTCAAACACACA
circ_0001173-divergent-R CTACGGGAGGAGAACAAGCA
circ_0001173-convergent-F TGTGTGTTTGAATTGCCAGC
circ_0001173-convergent-F TGCTTGTTCTCCTCCCGTAG