Skip to main content

Table 3 The siRNAs sequence

From: The role of circular RNA circ_0008285 in gestational diabetes mellitus by regulating the biological functions of trophoblasts

Name Sense (5′-3′) Antisense (5′-3′)
SiRNA-1 ACGGGAAAGGUUGAAAGGAUU AAUCCUUUCAACCUUUCCCGU
SiRNA-2 GUUAACGGGAAAGGUUGAA UUCAACCUUUCCCGUUAAC
SiRNA-3 AACGGGAAAGGUUGAAAGG CCUUUCAACCUUUCCCGUU
NC AAAGCGGUUUAUGGAAAAGGG CCCUUUUCCAUAAACCGCUUU