Skip to main content

Table 1 The primer of ncRNAs

From: The comprehensive detection of miRNA, lncRNA, and circRNA in regulation of mouse melanocyte and skin development

ncRNAsPrimers (5′–3′)
ENSMUST00000181605.1FCTGTATGTCAGATGGTCCGTG
RGCCAAGCCAGAGTTACCCA
NSMUST00000182499.7FAGCAAACAAGCCGTGGAA
RTGAGGCAAGTGGAGGAAGG
NONMMUT087719.1FGCAAGTCACTAGCTTCTTCCTC
RGTATCCTGTGAGACGGGTTTA
CircTmem26FCAAGACCCTGGAGACAGCA
RAACGAGGCCAAGGAGACA
CircBublbFAAAACGCCCTACCTTCCA
RTCAACAAGTCCACAGCCTCT
CircCnot2FAAACCAAGTAATCCACGAGAAG
RGACATCTTGAGCCATTTTGAAC
Mmu-miR-217TACTGCATCAGGAACTGACTGGA
Mmu-miR-211TTCCCTTTGTCATCCTTTGCCT
Mmu-miR-223CGTGTATTTGACAAGCTGAGTTG
Reverse primerCTCAACTGGTGTCGTGGGAGTC