Skip to main content

Table 1 The primer of ncRNAs

From: The comprehensive detection of miRNA, lncRNA, and circRNA in regulation of mouse melanocyte and skin development

ncRNAs Primers (5′–3′)
ENSMUST00000181605.1 F CTGTATGTCAGATGGTCCGTG
R GCCAAGCCAGAGTTACCCA
NSMUST00000182499.7 F AGCAAACAAGCCGTGGAA
R TGAGGCAAGTGGAGGAAGG
NONMMUT087719.1 F GCAAGTCACTAGCTTCTTCCTC
R GTATCCTGTGAGACGGGTTTA
CircTmem26 F CAAGACCCTGGAGACAGCA
R AACGAGGCCAAGGAGACA
CircBublb F AAAACGCCCTACCTTCCA
R TCAACAAGTCCACAGCCTCT
CircCnot2 F AAACCAAGTAATCCACGAGAAG
R GACATCTTGAGCCATTTTGAAC
Mmu-miR-217 TACTGCATCAGGAACTGACTGGA
Mmu-miR-211 TTCCCTTTGTCATCCTTTGCCT
Mmu-miR-223 CGTGTATTTGACAAGCTGAGTTG
Reverse primer CTCAACTGGTGTCGTGGGAGTC