Skip to main content

Table 1 The sequence of gRNAs and primers

From: Caspase-7 deficiency in Chinese hamster ovary cells reduces cell proliferation and viability

Oligoes Caspase 7 target site sequences
Exon 4 agatggcgtgacgccaataa Fw: CACCgAGATGGCGTGACGCCAATAA
Rev: AAACTTATTGGCGTCACGCCATCT
Exon 4 + PAM agatggcgtgacgccaataaagg Fw: caccgCCTTTATTGGCGTCACGCCATCT
Rev: aaacAGATGGCGTGACGCCAATAAAGGc
Exon 5 gatacgctttaggcatgccg Fw: CACCGATACGCTTTAGGCATGCCG
Rev: AAACCGGCATGCCTAAAGCGTATC
Exon 5 + PAM gatacgctttaggcatgccgagg Fw: caccCCTCGGCATGCCTAAAGCGTATC
Rev:aaacGATACGCTTTAGGCATGCCGAGG
PX-460-1 primers Fwd: GCCTTTTGCTGGCCTTTTGCTC
Rev:CGGGCCATTTACCGTAAGTTATGTAACG
Genomic primers Fwd: CTGAGGAGGACCACAGCAACTC
Rev: AACTGTGGAGTAAGCGAAGAGAA
\