Fig. 3

The presentations of gel electrophoresis, western blotting, and sequencing. a Gel electrophoresis of PCR products of both CHO-K1 (as control) and CHO-KO. Lane 1: ladder, lane 2: the PCR product of CHO-K1 using genomic primers (5′ CTGAGGAGGACCACAGCAACTC and 5′ AACTGTGGAGTAAGCGAAGAGAA), which produced a 580 bp band. Lane 3: the PCR product of CHO-KO using genomic primers (this PCR did not produce any band because the PCR product must be more than 5000 bp, which was not amplifiable by regular Taq DNA polymerase). Lane 4: a 310 bp PCR product produced by using caspase 7 genomic forward primer (5′ CTGAGGAGGACCACAGCAACTC) and a piece of PX460-1 vector (5′ CGGGCCATTTACCGTAAGTTATGTAACG) as a reverse primer. This band confirmed the integration of EGFP in the targeted site of the CHO-KO genome. b The presentation of western blotting. As this figure showed the genomic disruption in caspase 7 of CHO-KO cells resulted in the lack of producing of caspase 7 protein (33KD) in these cells. Beta actin was used as an endogenous control which expresses in both CHO-KO and CHO-K1 cells. c This picture depicts the sequencing of 310 bp fragment contained a piece of the pX460-1 vector which verified the EGFP integration in the target site of caspase 7