Skip to main content

Table 1 Oligonucleotide primer sets for real-time PCR

From: Novel mechanisms underlying anti-polycystic ovary like syndrome effects of electroacupuncture in rats: suppressing SREBP1 to mitigate insulin resistance, mitochondrial dysfunction and oxidative stress

Name Sequence (5′–3′) Length
CYP17 F TGGAGGTGATAAAGGGTT 18
CYP17 R CGTCAGGCTGGAGATAGA 18
CYP19 F GCCTGTCGTGGACTTGGT 18
CYP19 R TAAATTCATTGGGCTTGG 18
 SREBP1 F CGACTACATCCGCTTCTTACA 21
 SREBP1 R AGGTTTCATGCCCTCCATA 19
β-actin F CCACTGCCGCATCCTCTT 18
β-actin R GGTCTTTACGGATGTCAACG 20
\