Skip to main content

Table 1 Primers for qRT-PCR

From: Increased glucose metabolism in Arid5b−/− skeletal muscle is associated with the down-regulation of TBC1 domain family member 1 (TBC1D1)

Gene symbol Forward (5′–3′) Reverse (5′–3′)
Arid5b AGAAAAACGCCCATCGAGC CTCCCAGGATTACCACCTAAC
Rpl13a TGCTGCTCTCAAGGTTGTTC TTTCCTTCCGTTTCTCCTCC