Skip to main content

Table 2 Characteristics of nine microsatellite loci developed for Eremanthus erythropappus from Minas Gerais State, Brazil

From: Development and characterization of nuclear microsatellite markers for Eremanthus erythropappus and their transferability across related species

Locus Primer sequences (5′-3′) Repeat motif Size Tm (°C) GenBank
ERE02 F: TCTTGCTTACGCGTGTGACT (GA)21 119 53 MK075833
R: TGCATCCACTCCAATCACTT
ERE03 F: GAAGGGAGACATCGGAAGAA (CTT)5; (CTT)9; (CTT)10; (CTT)8 232 53 MK075834
R: ACGGAACGGAGAAGAAGAAA
ERE04 F: CAGTGAGGGGAAGGGAGAAT (CTT)37 398 53 MK075835
R: CCTCCACTATAGGGCGGAAT
ERE07 F: GCGTGGGACTAACCCATTC (CTT)9 120 53 MK075836
R: ACCTGTTGGTGAAAGGATGC
ERE08 F: GAGCCTTCCATGGGAGTAGG (AGC)5 238 53 MK075837
R: TGGGAGGGAGAAATTGAACA
ERE09 F: GCTTACGCGTGGGACTAACT (CA)3; (GA)8; (GTA)6 269 53 MK075838
R: GCGTGGACTAGGAAAACGAA
ERE10 F: GATCATCGCCATGAAGGAAT (GAA)3; ATA; (GAA)27 244 53 MK075839
R: CAGTGAGGGGAAGGGAGAAT
ERE13 F: GAGACCCTGGCTGTCTTCAT (CT)6; (CA)6 378 53 MK075840
R: GCGTTGAGTTTCGGAGAAGT
ERE14 F: CATCGATTTGGAGGCTTCAT (CT)11; (AT)8; (GT)18 207 53 MK075841
R: TGCTTACGTGTGCTCTTGCT
  1. Locus name, primer sequence (F: forward, R: reverse), repeat motif, fragment size (base pair), Temperature of melting (Tm), and GenBank accession numbers are shown