Skip to main content

Table 5 Characterization of the 13 polymorphic nuclear SSR markers

From: Development of nuclear SSR and chloroplast genome markers in diverse Liriodendron chinense germplasm based on low-coverage whole genome sequencing

Loci Forward primer sequences(5′ to 3′) Reverse primer sequences(5′ to 3′) Predicted size Motif Repeats A Ho He H’
Loci01 CGATAGCGAGAAGAGATACGGG AGAGAAAAATCAGGCCAGTCCA 248 CA 7 16 0.3564 0.8693 2.2622
Loci02 CGGGGTCTTGATTTTGGAGAGA CTGTAGACGTGCTCTTCCGATT 269 AG 10 8 0.3084 0.4916 1.0601
Loci03 GTTTTCTCCAATGCTCCACACC CTCTATAGTCCTCGTGTCGCAC 253 AG 13 24 0.2909 0.9344 2.9145
Loci04 CGTTTCAAATAGGTGGGAGGGA TGCTGTCCCAAAGCTTCACTAA 256 CT 7 21 0.7532 0.913 2.6479
Loci05 AGAGGAAGTGGAGGAAGAAGGA TGCCCTCATTTATCTCTCTCGC 168 AG 13 12 0.1101 0.1919 0.5557
Loci06 TCGAGTTGGCGAGTAATTGTCA TCTTTGTCGCTTTCTCTCCCTC 250 AG 14 21 0.573 0.9156 2.6439
Loci07 ATGTCCAGTCGTAGAAGGGAGA ATCTTACAAATTCCCCCTGGGC 280 TC 13 27 0.7733 0.9023 2.7063
Loci08 CCAAGACGAGAACGATCGATCT AAGTGAGAAAATGCACGTGGTG 157 TC 7 19 0.7113 0.8737 2.4331
Loci09 AGGGGATTACTGACGTCGAGTA GAGTATCATAGGCCCATTACCCT 260 AG 13 28 0.3486 0.9198 2.8313
Loci10 GGATTTAGTTCGGGGAAGACGT TAGGGCCGTTTGCAACATTTTT 236 CT 7 22 0.1972 0.9059 2.606
Loci11 CATGCCAGGCCTGTTAAAAGTC GCTAGCTCTGACAGGCTTCTAG 179 GT 7 25 0.7944 0.9034 2.5901
Loci12 GGCACAGATCAAAAATCGCACT CTTCCATGCCTCTCCGCCATTA 140 GA 18 24 0.7156 0.7804 1.9415
Loci13 CAACCTTCTCTGTCACCTCCG ATAAGTAGTGGAGAGCATGCGG 145 TC 14 26 0.486 0.9221 2.8333
Mean       21 0.4937 0.8095 2.3097
  1. A number of alleles, Ho observed heterozygosity, He expected heterozygosity, H’ Shannon‐Wiener diversity