Skip to main content

Table 1 Primer sequences for reverse transcription quantitative polymerase chain reaction

From: Neuroprotective effects of an Nrf2 agonist on high glucose-induced damage in HT22 cells

Gene Forward primers Reverse primers
Nrf2 GAAATGATGTCCAAGGAGCAA AAGACTTCAAGATACAAGGTGCTG
NF-κB ACCCTGAAATCAAAGACAAAGAG GAAATCCGTAGTTCGAGTAGCC
HO-1 TGACAGAAGAGGCTAAGACCG GTGAGGACCCACTGGAGGA
GAPDH ATTCAACGGCACAGTCAAGG CACCAGTGGATGCAGGGAT