Skip to main content

Table 1 List of designed primers for real-time polymerase chain reaction

From: Berberine in combination with cisplatin induces necroptosis and apoptosis in ovarian cancer cells

Primer name Primer sequence
Caspase3 (NM_004346.3) Forward: 5′ GTTTGAGCCTGAGCAGAGAC 3′
Reverse: 5′ TGGCAGCATCATCCACAC 3′
Caspase-8 Forward: 5′ TGTGCCCAAATCAACAAGAG 3′
Reverse: 5′ TTCAAAGGTCGTGGTCAAAG 3′
Ki67 Forward: 5′ GTGCGAAGGTTCTCATGC 3′
Reverse: 5′ CTTGACACTCCGCGTTAC 3′
PCNA Forward: 5′ GCTCTTCCCTTACGCAAGTC 3′
Reverse: 5′ AGTGCCTCCAACACCTTC 3′
RIPK3 Forward: 5′ CGCCTGCTGAAAGAAGTG 3′
Reverse: 5′ GTGAGCCTCCCTGAAATG 3′
MLKL Forward: 5′ CCTGTTTCACCCATAAGC 3′
Reverse: 5′ GACTGCCTCAAAGTTTCC 3′
GAPDH Forward: 5′ CACCCACTCCTCCACCTTTG 3′
Reverse: 5′ CCACCACCCTGTTGCTGTAG 3′