Skip to main content

Advertisement

Table 1 List of primers used in qRT-PCR analysis

From: Notum attenuates HBV-related liver fibrosis through inhibiting Wnt 5a mediated non-canonical pathways

Target Species Forward 5′–3′ Reverse 5′–3′
α-SMA Human AAAAGACAGCTACGTGGGTGA GCCATGTTCTATCGGGTACTTC
TIMP-1 Human ACTTCCACAGGTCCCACAAC GCTAAGCTCAGGCTGTTCCA
Col 1A1 Human CAGCCGCTTCACCTACAGC TCAATCACTGTCTTGCCCCA
NFATc1 Human CAACGCCCTGACCACCGATAG GGCTGCCTTCCGTCTCATAGT
Wnt 5a Human GGACCACATGCAGTACATCG CCTGCCAAAAACAGAGGTGT
GAPDH Human ACCTTCCCCATGGTGTCTGA GCTCCTCCTGTTCGACAGTCA