Skip to main content

Table 1 primer sequences for real time PCR

From: ErbB1 and ErbB3 co-over expression as a prognostic factor in gastric cancer

Primer sequence (5′ to 3′) Amplified target Size of amplicon (bp)
GGAGAACTGCCAGAAACTGACC ErbB1–Exon junction 5–6 106
GCCTGCAGCACACTGGTTG ErbB1–Exon 6  
CCCTGCCATGAGAACTGCAC ErbB3–exon15 112
TCACTGTCAAAGCCATTGTCAGAT ErbB3–exon17