Skip to main content

Table 1 Characteristics of 10 microsatellite loci and primer pair’s development for G. pumila

From: Development and characterization of microsatellite markers in Gaultheria pumila Lf. (Ericaceae)

Locus Primer sequences (5′–3′) Products size Repeat motif size (bp) Dye Ta (°C) GenBank
GP.7 F: CGCATTCACTCACCCTCTCA 309 (ACTC)^4 360 FAM 52.1 KX719822
R: TGGTTGGTGAAGGCTTTGGA       
GP.9 F: ACCCGCTCTAGATCCTCTCT 321 (T)^10 378–380 FAM 60.5 KX719823
R: AGGGGGAGTAATCAAGCCTCT       
GP.10 F: GGGTACGGCGTAGTGGTAAT 269 (AT)^8 323–327 VIC 60.5 KX719824
R: TCGTACAAAACCGCCCTCAA       
GP.12 F: AGGATTATAGAGAGCCAGGTGGA 138 (CTT)^4 198–201 NED 52.1 KX719825
R:CAGAAGACGAAATCGAAGCCG       
GP.13 F: AGAGTAAGAGCTCTCTTCCGA 248 (ATT)^4 161–278 NED 52.1 KX719826
R: GCAGACTCGAATCGGCAGTA       
GP.14 F: GCATAGCCCGGTTGTCAAAC 174 (ACGC)^4 196–228 PET 52.1 KX719827
R: ACCGAAAGATCCGACCATCG       
GP.15 F: GGGCTGCTGCTCAATCAATT 287 (T)^10 347–351 VIC 52.1 KX719828
R: ACCCGCTTCAAGTCATGATGA       
GP.16 F: GCTATTTCTAGGGCCGGACC 218 (AT)^6 281–283 FAM 52.1 KX719829
R: GCACAATACATAGATTCTGGATCGA       
GP.17 F: GAGAGAAATCCACCAGGGCA 145 (T)^10 202–205 VIC 60.5 KX719830
R: CAAGCGGACGACGTATACGA       
GP.18 F: ACCGAAAGATCCGACCATCG 174 (GCGT)^4 192–228 PET 52.1 KX719831
R: GCATAGCCCGGTTGTCAAAC       
  1. For each locus, the name, primer sequence, products size, repeat motif, allele size range (bp), fluorescent dye, annealing temperature (Ta) and GenBank accession numbers