Skip to main content

Table 4 The primer sequence for each validated gene

From: Dysregulation of NCAPG, KNL1, miR-148a-3p, miR-193b-3p, and miR-1179 may contribute to the progression of gastric cancer

Primer name Primer sequence (5′-3′)
U6-F CTCGCTTCGGCAGCACA
U6-R AACGCTTCACGAATTTGCGT
Human-U6-RT GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACAAAATATG
GAPDH-F TGACAACTTTGGTATCGTGGAAGG
GAPDH-R AGGCAGGGATGATGTTCTGGAGAG
MYC-F CCTGGTGCTCCATGAGGAGAC
MYC-R CAGACTCTGACCTTTTGCCAGG
NCAPG-F TTAAGGAGGCCTTTCGGCTG
NCAPG-R TCCACAGCTGGTTCACGTTT
CASC5-F AGAAATGGAAGAAACAGAAACAGG
CASC5-R TGCATGTTTCCTTTCACGGG
hsa-miR-148a-3p-RT GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACACAAAG
JH-hsa-miR-148a-3p-F GCGCTCAGTGCACTACAGAA
hsa-miR-193b-3p-RT GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACAGCGGG
JH-hsa-miR-193b-3p-F GCGCAACTGGCCCTCAAAGT
hsa-miR-1179-RT GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACCAACCA
JH-hsa-miR-1179-F GCGCGCAAGCATTCTTTCAT
\