Skip to main content

Table 1 The primers used in real time PCR

From: Bioinformatics analysis of microarray data to reveal the pathogenesis of diffuse intrinsic pontine glioma

Primer name Sequences (5′-3′)
GRM2-hF GCTCCACTCCGATTCTCTCC
GRM2-hR GAAGCAGCGAAGGCAAAGAG
GRM7-hF GACACTTACGCGCTCGAACA
GRM7-hR TCATCACTTAGCTCGGGTGC
HTR2A-hF CTGGTCTGCTTTACTGACAGCC
HTR2A-hR AGAGCACGTCCAGGTAAATCC
GAPDH-hF TGACAACTTTGGTATCGTGGAAGG
GAPDH-hR AGGCAGGGATGATGTTCTGGAGAG
\