Skip to main content

Advertisement

Springer Nature is making SARS-CoV-2 and COVID-19 research free. View research | View latest news | Sign up for updates

Table 1 Primer sequences used in this study

From: Study on the relationship between expression patterns of cocaine-and amphetamine regulated transcript and hormones secretion in porcine ovarian follicles

Primer name Sequence (5′to 3′) Tm (°C) Size (bp)
CART-F TATGTGTGACGCAGGAGAGC 59.3 102
CART-R AAGGAATTGCAGGAGGTTCC 59.8
β-Actin-F CCAGCACCATGAAGATCAAG 60.0 93
β-Actin-R ACATCTGCTGGAAGGTGGAC 60.0
  1. F sense primers, R antisense primers