Skip to main content

Table 1 Primer sequences and associated PCR conditions

From: Expression regulation and functional analysis of RGS2 and RGS4 in adipogenic and osteogenic differentiation of human mesenchymal stem cells

  Forward sequence Reverse sequence Product size (bps) Annealing Tm (°C)
HSP90-beta TACTTGGTGGCAGAGAAAGT CTCATCTGAACCCACATCTT 441 60
RGS2 CAAACAGCCGGGACTCCAGC TGCTGGCATGCAGCTGGTCA 303 63.5
RGS4 TCCCTGGTCCCTCAGTGTGCC AAGCATGCCCTGAGCACCCA 958 64
PPARγ AAGCCCTTCACTACTGTTGA ACCTGATGGCATTATGAG AC 444 56
CEBPα CCTAAGGTTGTTCCCCTAGT GAGAGTCTCATTTTGGCAAG 547 58
LPL GTCCGTGGCTACCTGTCATT AGCCCTTTCTCAAAGGCTTC 717 60
Runx2 TCTTCACAAATCCTCCCC TGGATTAAAAGGACTTGGTG 230 55
OC CTACCTGTATCAATGGCTG CAGATTCCTCTTCTGGAGTTTA 310 56
ALPL TGGAGCTTCAGAAGCTCAACA ATCTCGTTGTCTGAGTACCAG 450 60
CDK1 GGATCTACCATACCCATTGAC CCATGTACTGACCAGGAGGG 327 55
CDK2 TGACTCGCCGGGCCCTATTCC CCCAAGGCCAAGCCTGGTCA 381 60
CDK4 AGTTTCCGCGCGCCTCTTTG GGCACAGACGTCCATCAGCCG 455 63 
CCND1 CTCCAGAGGGCTGTCGG CTCGGCCGTCAGGGGGA 528 60
Runx2/p57 CGC CTC ACA AAC AAC CAC AG TCA CTG TGC TGA AGA GGC TG 225 60