Skip to main content

Table 2 The primers for detection of PDCoV used in this study

From: A simple and rapid identification method for newly emerged porcine Deltacoronavirus with loop-mediated isothermal amplification

Test Primer ID Type Length (bp) Sequence (5′–3′)
RT-LAMP PDCoV-F3 Forward outer 18 CGGCTCTGCAGACACTGA
PDCoV-B3 Reverse outer 19 CCGTATTGAGCGCATCCTT
PDCoV-FIP Forward inner 42 GCATTTCCTGAACACCAGGCACGAAGACGGGTATGGCTGATC
PDCoV-BIP Reverse inner 41 CTGGCCACCTTGAGAGCAACTAGAACCCTCCTTGACTGTGA
RT-PCR PDCoV-NF Forward 22 CCAAACGCAACCCCAACAATCC
PDCoV-NR Reverse 22 CTTCTCAGTGTCTGCAGAGCCG
Nested RT-PCR PDCoV-OF Forward outer 20 TGCTACCTCTCCGATTCCCA
PDCoV-OR Reverse outer 20 ATCCTGTTTGTCTGCTGGCA
PDCoV-IF Forward inner 22 GACACTGAGAAGACGGGTATGG
PDCoV-IR Reverse inner 22 TAGTTGGTTTGGTAGGTGGCTC
Standard control PDCoV-NWF Forward 21 ATGGCCGCACCAGTAGTCCCT
PDCoV-NWR Reverse 20 CTACGCTGCTGATTCCTGCT
\