Skip to main content

Table 1 Primer sequences used in this study

From: Expression of cocaine- and amphetamine-regulated transcript (CART) in hen ovary

Primer name Sequence (5′ to 3′) Tm (°C) Size (bp)
RT-PCR
 CART-F AGCGCGGCTCGGCGGGATTCGGCAGC 58.7 396
 CART-R GGGCGGACGTGCACCGCGCCGGTGCC 58.7
qRT-PCR
 CART-R-F GAGAAGGAGCTGATCGAGGC 60.0 88
 CART-R-R CCTGCCCGAACTTCTTTTCG 59.5
 β-actin-F AATGGCTCCGGTATGTGCAA 60.0 112
 β-actin-R GGCCCATACCAACCATCACA 60.0
  1. F, sense primers; R, antisense primers