Skip to main content

Table 2 Primer pairs used for gene amplification in bovine mammary epithelial cells

From: Can widely used cell type markers predict the suitability of immortalized or primary mammary epithelial cell models?

Gene Accession number Primer pairs (5′- end to 3′- end) Product length (bp)
α-SMA NM_001034502 For: GGTGATGAAGCACAAAGCAA
Rev: TGAGAAGGGTTGGATGCTCT
154
Vimentin NM_173969.3 For: CGCTCAAAGGGACTAACGAG
Rev: TGACATTCAGCAGGTCTTGG
174
CK7 NM_001046411.1 For: TTACCAGACCAAGTTTGA
Rev: ATCTCATTCCGGGTATTC
78
CK18 NM_001192095.1 For: ATTGATAATGCCCGTCTTGC
Rev: AGCCTCGATCTCAGTCTCCA
156
CK19 NM_001015600.3 For: GATGACTTCCGCACCAAGTT
Rev: AGCAGAATCCACCTCCACAC
234
Beta actin XM_006715764.1 For: AACTCCATCATGAAGTGTGACG
Rev: GATCCACATCTGCTGGAAGG
234
Ubiquitin see [39] For: TTCACAGGTCAAAATGCAGA
Rev: ATCTGCATACCACCCCTCAG
237a
  1. aPrimers are obtained from the above mentioned studies
  2. Bp base pairs, CK cytokeratin
\