Skip to main content

Table 2 Primer pairs used for gene amplification in bovine mammary epithelial cells

From: Can widely used cell type markers predict the suitability of immortalized or primary mammary epithelial cell models?

Gene Accession number Primer pairs (5′- end to 3′- end) Product length (bp)
Beta actin XM_006715764.1 For: AACTCCATCATGAAGTGTGACG
Ubiquitin see [39] For: TTCACAGGTCAAAATGCAGA
  1. aPrimers are obtained from the above mentioned studies
  2. Bp base pairs, CK cytokeratin