Skip to main content

Table 1 Primer sequences of real-time PCR

From: Tridax procumbens flavonoids promote osteoblast differentiation and bone formation

Gene Forward Reverse
Alkaline phosphatase 5′ ACAGCCATCCTGTATGGCAA 3′ GCCTGGTAGTTGTTGTGAGCA
Osteocalcin 5′ TGAGGACCATCTTCTGCTCA 3′ TGGACATGAAGGCTTTGTCA
Osterix 5′ TATGCTCCGACCTCCTCAACT 3′ TCCTATTTGCCGTTTTCCCGA
Runx2 5′ GATCTGAGATTTGTAGGCCG 3′ TCATCAAGCTTCTGTCTGTGCC
BMP-2 5′ CGGACTGCGGTCTCCTAA 3′ GGGAAGCAGCAACACTAGA
BMP-4 5′ GACTTCGAGGCGACACTTCT 3′ GCCGGTAAAGATCCCTCATGTA
BMP-7 5′ GAAAACAGCAGCAGTGACCA 3′ GGTGGCGTTCATGTAGGAGT