Skip to main content

Table 1 Primer sequences of real-time PCR

From: Flavonoids isolated from Tridax procumbens (TPF) inhibit osteoclasts differentiation and bone resorption

Gene Forward Reverse
TRAP 5′CGTCTCTGCACAGATTGCAT 3′AAGCGCAAACGGTAGTAAGG
Cathepsin K 5′CGAAAAGAGCCTAGCGA 3′TGGGTAGCAGCAGAAACA
MM9 5′GAACCAATCTCACCGACAGG 3′GCCACCCGAGTGTAACCATA
MM13 5′GTCTGAGATTTGTAGGCCG 3′TCATCAAGCTTCTGTCTGTGC
\