Skip to main content

Table 3 Oligonucleotides used in the MSP

From: Colorectal cancer DNA methylation patterns from patients in Manaus, Brazil

Primer pair Methylated set (5′–3′) upstream/downstream Unmethylated set (5′–3′) upstream/downstream References
TIMP2 5′-AATAAAATTGCGGTTCGGTTTAAGTTC-3′
5′-CTCTCCTCTTTATCTCGAAAACGCG-3′
5′-GTAATAAAATTGTGGTTTGGTTTAAGTTT-3′
5′-TTCTCTCCTCTTTATCTCAAAAACACA-3′
[38]
CDKN2A 5′-TTATTAGAGGGTGGGGCGGATCGC-3′
5′- GACCCCGAACCGCGACCGTAA -3′
5′-TTATTAGAGGGTGGGGTGGATTGT-3′
5′CAACCCCAAACCACAACCATAA-3′
[37]
DAPK 5′-GGATAGTCGGATCGAGTTAACGTC-3′
5′-CCCTCCCAAACGCCGA-3′
5′-GGAGGATAGTTGGATTGAGTTAATGTT-3′
5′-CAAATCCCTCCCAAACACCAA-3′
[35]
CDH1 5′- GTGAATTTTTAGTTAATTAGCGGTAC-3′
5′-CATAACTAACCGAAAACGCCG-3′
5′- GTAGGTGAATTTTTAGTTAATTAGTGGTA3′
5′-ACCCATAACTAACCAAAAACACCA-3′
[36]
  1. Oligonucleotides were used for regions containing frequent cytosines (to distinguish between modified and unmodified DNA) and contained CpG dinucleotides at the 3′ end (to provide maximal discrimination between methylated and unmethylated DNA). For each row, the gene names are listed in the primer pair column viz.: TIMP2 tissue inhibitor of metalloproteinases, CDKN2A cyclin dependent kinase 2a/p16, DAPK death-associated protein kinase, CDH1 Cadherin 1
\