Skip to main content

Table 1 Sequences of primers used for Real-time PCR

From: Integrin-β1, not integrin-β5, mediates osteoblastic differentiation and ECM formation promoted by mechanical tensile strain

Gene Primer sequence (5′-3′) Length (bps)
ITGβ1 F: GCAACGCATATCTGGAAACA; R: CAAAGTGAAACCCAGCTACC 140
ITGβ5 F:TCCTGCTTCGAGAGTGAGT; R: CCTGCGTGGCATTTGCATT 137
ALP F: CGGGACTGGTACTCGGATAA; R: ATTCCACGTCGGTTCTGTTC 157
OCN F:AGTCTGACAAAGCCTTCA; R:AAGCAGGGTTAAGCTCACA 134
OPG F:AGTCTGAGGAAGACCATGAG; R:AAACAGCCCAGTGACCATTC 205
GAPDH F: ACCCATCACCATCTTCCAGGAG; R: GAAGGGGCGGAGATGATGAC 159