Skip to main content

Table 1 Primer used for real-time PCR

From: The TLR7 agonist Imiquimod promote the immunogenicity of msenchymal stem cells

Gene Forward primer Reverse primer GenBank number
IL-1β ACGAATCTCCGACCACCACT CCATGGCCACAACAACTGAC M15330
IL-6 GACCCAACCACAAATGCCA GTCATGTCCTGCAGCCACTG M14584
IL-8 CTGGCCGTGGCTCTCTTG CCTTGGCAAAACTGCACCTT NM_000584
IL-12 CGGTCATCTGCCGCAAA CAAGATGAGCTATAGTAGCGGTCC M65272
IFN-β CAGCAATTTTCAGTGTCAGAAGCT TCATCCTGTCCTTGAGGCAGT M28622
NF-κB AGAGTGCTGGAGTTCAGGATA AAGGTGGATGATTGCTAAGTGT AJ271718
TGF-β TATCGACATGGAGCTGGTGAAG CAGCTTGGACAGGATCTGGC X02812
TNF-α GGTGCTTGTTCCTCAGCCTC CAGGCAGAAGAGCGTGGTG M10988
CXCL6 GCTGAGAGTAAACCCCAAAACG GGAGCACTGCGGGCC NM_002993
CCL7 CTGCTCTCCAGCGCTCTCA GTAAGAAAAGCAGCAGGCGG NM_002984
CCL15 AGCAGAGGCTGGAGAGCTACA GGGTCAGCACAGATCTCCTTGT NM_006273
CCL26 CCTCTCCTGCCTCATGCTTATT CTCTGTCTCTGCATCATTTGTGAA U58914
Lin28 TGCTGTCGAGGGATGGATA CCACCCAATGCGTTCTATTG NM_024674
Otx2 TCGGGCGCAGCTAGATGT TGTCTGGGTACCGGGTCTTG NM_001270525
Sox2 CCCCTTTATTTTCCGTAGTTGTAT GATTCTCGGCAGACTGATTCAA NM_003106
Sox17 TGGCGCAGCAGAATCCA CGACTTGCCCAGCATCTTG NM_022454
GAPDH GAAGGTGAAGGTCGGAGTC GAAGATGGTGATGGGATTTC J04038