Skip to main content

Table 1 Sequences and accession numbers for forward and reverse primers used in Real-Time PCR

From: Expression of non-neuronal cholinergic system in maxilla of rat in vivo

Name Genbank No. Forward Reverse
CarAT NM_001004085 ATTGTCGCTCTTGTGGACC TCTGTTTGGCCTTCTCTATGTC
OCTN2 NM_019269 CGATCCCAGTGAGTTACAAGAC GAGAAAGTCCGAAGTAGCCC
OCT1 NM_012697 TGGCCGTAAGCTCTGTCTCT TCAAGGTATAGCCGGACACC
OCT3 NM_019230 CAATGGGAAACACCTCTCGT ATACACCACGGCACTTGTGA
SLC22a4 NM_022270 CTGGGAGTACAGCAAGGA GAAGGAGCCACAGAGAAC
SLC25a20 NM_053965 AACCCATCAGTCCGCTTAAG TGGTCCCAGAGTACATAGGTG
VAChT X80395 GCCACATCGTTCACTCTCTTG CGGTTCATCAAGCAACACATC
AChE S50879 CTTCTCCCACACCTGTCC CTGCTTCCTGGTAGAGCC
BChE NM_022942 ACCTAACCTTGAACACAGAGAAG TTCCACTCTTGCTCCCTTTC
α1 NM_024485 GTCACCCACTTTCCCTTCGA CAGGTCGGGCTGGTCACTT
α2 NM_133420 CGCTGGTCATCCCACTCAT GGGAGCGGTGGTGTACATTG
α3 NM_052805 TCCAGTTTGAGGTGTCCATG CTTGGTAGTCAGAGGGTTTCC
α4 NM_024354.1 CGCATCCCCTCTGAACTCAT CACTGCACCCTTCCGTCATA
α5 NM_017078 TGGACGCAACCAGCAAACTA TATGTCCACGAGCCGAATTTC
α7 AY574256 GCTGGTTCCCTTTTGATG CTCCGTTGGGGATATAGC
α10 AF196344 CAGTCTCTCCCCAAAGTG GAGGTGGGCTTTAGATCC
β1 X74833 TGGTTGTGGACCGTCTTTTTC ATGACCGGAGGGTCCTCAAG
β2 L31622 TTCCTGCTGCTCATCTCCAA CGCTGGTGACGATGGAGAA
β3 NM_133597.1 TGGAAACACTCTGCGCTTGA TCCTGCAGTGGCCGTAAGA
β4 AY574260 TGCTGGCACTCACGTTCTTC AAGGTGACCAGCACCATGGT
γ NM_019145 CACCTACTTCCCCTTCGATTG ATTCTCTGTGAAAGCCTCGG
M1 NM_080773 TGGTTTCCTTCGTTCTCTGG GAGGAACTGGATGTAGCACTG
M2 J03025 CCACTCCAGAGATGACAACT GGCTACAACGTTCTGCTTT
M3 M16407 GGACTGTGGATGTGGAGAG CGAGGAGTTGGTGTCAGA
M4 NM_031547 CCCGCCGCACTACTAAGATG CCTCTTGCCCACCACAAACT
M5 M22926 CAGCTGCTGCTCACAGACTCA GGGAAGGAACAGGGCATGAT
β-actin NM_031144 CTTCAACACCCCAGCCATGT CAGAGGCATACAGGGACAACA
18S M11188 GCGGTTCTATTTTGTTGG AATGCTTTCGCTCTGGTC
\