Skip to main content

Table 2 Sequences of the primers for Real-time qRT-PCR

From: Simultaneous silencing of VEGF and KSP by siRNA cocktail inhibits proliferation and induces apoptosis of hepatocellular carcinoma Hep3B cells

Gene Sequences (5’–3’) Product size (bp)
VEGF F: CCATGAACTTTCTGCTGTCTT 250
R: ATCGCATCAGGGGCACACAG
KSP F: CTGAACAGTGGGTATCTTCCTTA 480
R: GATGGCTCTTGACTTAGAGGTTC
Cyclin D1 F: GCCCGAGGAGCTGCTGCAAA 358
R: CCTGGCGCAGGCTTGACTCC
Bcl-2 F: CGGTGCCACCTGTGGTCCAC 174
R: TCCCCCAGTTCACCCCGTCC
Survivin F: GGACCGCCTAAGAGGGCGTGC 145
R: AATGTAGAGATGCGGTGGTCCTT
ANG2 F: TGGGATTTGGTAACCCTTCA 234
R: GTAAGCCTCATTCCCTTCCC
β-actin F : ACACTGTGCCCATCTAGGAGG 680
  R: AGGGGCCGGACTCGTCATACT  
  1. F and R are Forward and Reverse, respectively.
\