Skip to main content

Table 9 Primer sequence of BOX-AIR and ERIC1R/ERIC2

From: Stress tolerant virulent strains of Cronobacter sakazakii from food

Primer Sequence 5’ to 3’ Reference
ERIC1R ATGTAAGCTCCTGGGGATTCACf [36]
ERIC2 AAGTAAGTGACTGGGGTGAGCG
BOX-A1R CTACGGCAAGGCGACGCTGACGg [37]
  1. f&gRunning conditions; 94°C for 8 min; 35 cycles of 94°C for 30 sec each; 55°C for 1 min; 72°C for 8 min; a final extension period of 10 min at 72°C.