Skip to main content

Table 1 PCR characteristic of primers for constitutive and growth factors genes evaluated in the present study

From: Growth differentiation factor 9 and bone morphogenetic protein 15 expression in previtellogenic oocytes and during early embryonic development of Yellow-tail Kingfish Seriola lalandi

Gene Primer sequences (5′-3′) Tm (°C) Efficency Amplicon (bp)
β-actin F: AGGGAAATCGTGCGTGACAT 57 2,04 191