Skip to main content

Table 7 Oligonucleotid primers used for detection of virulence factors, serogroups and antibiotic resistance genes in STEC strains isolated from calves with diarrhea

From: Characterization of Escherichia coli virulence genes, pathotypes and antibiotic resistance properties in diarrheic calves in Iran

Primer name Sequence (5’-3’) Size of product (bp) Target gene References
Hly-F GAGCGAGCTAAGCAGCTTG 889 hlyEHEC [6]
Hly-R CCTGCTCCAGAATAAACCACA
Stx1-F CAGTTAATGTGGTGGCGAAGG 348 Stx1 [53]
Stx1-R CACCAGACAATGTAACCGCTG
Stx2-F ATCCTATTCCCGGGAGTTTACG 584 Stx2 [53]
Stx2-R GCGTCATCGTATACACAGGAGC
Eae-F TGCGGCACAACAGGCGGCGA 629 eae [6]
Eae-R CGGTCGCCGCACCAGGATTC
Cnf1-F GGGGGAAGTACAGAAGAATTA 1111 cnf1 [21]
Cnf1-R TTGCCGTCCACTCTCTCACCAGT
Cnf2-F TATCATACGGCAGGAGGAAGCACC 1240 cnf2 [21]
Cnf2-R GTCACAATAGACAATAATTTTCCG
Cdt3-F GAAAATAAATGGAATATAAATGTCCG 555 cdt-III [21]
Cdt3-R TTTGTGTCGGTGCAGCAGGGAAAA
F17c-F GCAGGAACCGCTCCCTTGGC 416 f17c [23]
F17c-R CAACTAACGGGATGTACAGTTTC
LT-F GCACACGGAGCTCCTCAGTC 218 ltII [53]
LT-R TCCTTCATCCTTTCAATGGCTTT
ST-F AGGAACGTACATCATTGCCC 521 st [54]
ST-R CAAAGCATGCTCCAGCACTA
O26-F CAG AAT GGT TAT GCT ACT GT 423 wzx [55]
O26-R CTT ACA TTT GTT TTC GGC ATC
O103-F TTGGAGCGTTAACTGGACCT 321 wzx [55]
O103-R GCTCCCGAGCACGTATAAG
O111-F TAG AGA AAT TAT CAA GTT AGT TCC 406 wzx [55]
O111-R ATA GTT ATG AAC ATC TTG TTT AGC
O145-F CCATCAACAGATTTAGGAGTG 609 wzx [55]
O145-R TTTCTACCGCGAATCTATC
O157-F CGG ACA TCC ATG TGA TAT GG 259 wzx [55]
O157-R TTG CCT ATG TAC AGC TAA TCC
O45-F CCG GGT TTC GAT TTG TGA AGG TTG 527 wzx1 [56]
O45-R CAC AAC AGC CAC TAC TAG GCA GAA
O91-F GCTGACCTTCATGATCTGTTGA 291 gnd [57]
O91-R TAATTTAACCCGTAGAATCGCTGC
O113-F GGGTTAGATGGAGCGCTATTGAGA 771 wzx [12]
O113-R AGGTCACCCTCTGAATTATGGCAG
O121-F TGGCTAGTGGCATTCTGATG 322 wzx [58]
O121-R TGATACTTTAGCCGCCCTTG
O128-F GCTTTCTGCCGATATTTGGC   galF [59]
O128-R CCGACGGACTGATGCCGGTGATT
aadA1-F TATCCAGCTAAGCGCGAACT 447 Streptomycin resistance [60]
aadA1-R ATTTGCCGACTACCTTGGTC
tetA- F GGTTCACTCGAACGACGTCA 577 Tetracycline resistance [60]
tetA- R CTGTCCGACAAGTTGCATGA
tetB- F CCTCAGCTTCTCAACGCGTG 634 Tetracycline resistance [60]
tetB- R GCACCTTGCTGATGACTCTT
dfrA1- F GGAGTGCCAAAGGTGAACAGC 367 Trimethoprim resistance [61]
dfrA1- R GAGGCGAAGTCTTGGGTAAAAAC
Qnr- F GGGTATGGATATTATTGATAAAG 670 Fluoroquinolone resistance [62]
Qnr- R CTAATCCGGCAGCACTATTTA
aac [3] -IV- F CTTCAGGATGGCAAGTTGGT 286 Gentamicin resistance [63]
aac [3] -IV- R (TCATCTCGTTCTCCGCTCAT
Sul1- F TTCGGCATTCTGAATCTCAC 822 Sulfonamide resistance [63]
Sul1- R ATGATCTAACCCTCGGTCTC
blaSHV- F TCGCCTGTGTATTATCTCCC 768 Cephalothin resistance [63]
blaSHV- R CGCAGATAAATCACCACAATG
CITM- F TGGCCAGAACTGACAGGCAAA 462 Ampicillin resistance [63]
CITM- R TTTCTCCTGAACGTGGCTGGC
ereA- F GCCGGTGCTCATGAACTTGAG 419 Erythromycin resistance [63]
ereA- R CGACTCTATTCGATCAGAGGC
cat1- F AGTTGCTCAATGTACCTATAACC 547 Chloramphenicol resistance [63]
cat1- R TTGTAATTCATTAAGCATTCTGCC
cmlA-F CCGCCACGGTGTTGTTGTTATC 698 Chloramphenicol resistance [63]
cmlA-R CACCTTGCCTGCCCATCATTAG