Open Access

Characterization of Escherichia coli virulence genes, pathotypes and antibiotic resistance properties in diarrheic calves in Iran

  • Masoud Shahrani1,
  • Farhad Safarpoor Dehkordi1 and
  • Hassan Momtaz2Email author
Biological Research201447:28

DOI: 10.1186/0717-6287-47-28

Received: 9 January 2014

Accepted: 5 June 2014

Published: 23 June 2014

Abstract

Background

Calf diarrhea is a major economic concern in bovine industry all around the world. This study was carried out in order to investigate distribution of virulence genes, pathotypes, serogroups and antibiotic resistance properties of Escherichia coli isolated from diarrheic calves.

Results

Totally, 76.45% of 824 diarrheic fecal samples collected from Isfahan, Chaharmahal, Fars and Khuzestan provinces, Iran were positive for E. coli and all of them were also positive for cnf2, hlyA, cdtIII, f17c, lt, st, stx1, eae, ehly, stx2 and cnf1 virulence genes. Chaharmahal had the highest prevalence of STEC (84.61%), while Isfahan had the lowest (71.95%). E. coli serogroups had the highest frequency in 1–7 days old calves and winter season. Distribution of ETEC, EHEC, AEEC and NTEC pathotypes among E. coli isolates were 28.41%, 5.07%, 29.52% and 3.49%, respectively. Statistical analyses were significant for presence of bacteria between various seasons and ages. All isolates had the high resistance to penicillin (100%), streptomycin (98.25%) and tetracycline (98.09%) antibiotics. The most commonly detected resistance genes were aadA1, sul1, aac[3]-IV, CITM, and dfrA1. The most prevalent serogroup among STEC was O26.

Conclusions

Our findings should raise awareness about antibiotic resistance in diarrheic calves in Iran. Clinicians should exercise caution when prescribing antibiotics.

Keywords

Antibiotic resistance profile Diarrheic calves Escherichia coli Iran Serogroups Virulence genes

Background

Calf diarrhea is one of the most economic and pervasive concern in veterinary industry all around the world. Infectious agents are the most commonly detected causes of calf diarrhea [13]. Several studies have been addressed the high distribution of Escherichia coli (E. coli) strains in infectious calf diarrhea [36]. Escherichia coli is a gram-negative, rod-shaped, flagellated, non-sporulating and facultative anaerobic bacterium of the family enterobacteriaceae that classically classified into enterohemorrhagic (EHEC), enterotoxigenic (ETEC), necrotoxigenic (NTEC), enteroinvasive (EIEC), enteropathogenic (EPEC) and attaching and effacing E. coli (AEEC) pathotypes [7]. Intimin genes are present in EPEC and some Shigatoxin-producing E. coli (STEC). EPEC strains are defined as eae harbouring diarrhoeagenic E. coli that possess the ability to form attaching-effacing (A/E) lesions on intestinal cells and that do not possess Shigatoxin encoding genes [8, 9]. Diarrheagenic Escherichia coli are now broadly placed into 6 classes based on virulence mechanisms. One of these classes, enterotoxigenic E. coli, is the most common cause of diarrhea in beef and dairy calves in the first 4 days of life. Two other diarrheagenic classes, EHEC and EPEC, are important causes of disease in human beings, but less well substantiated causes of diarrhea in calves [8, 9]. E. coli strains that cause hemorrhagic colitis and hemolytic uremic syndrome in humans, express high levels of Shiga toxin, cause A/E lesions in intestinal epithelial cells, and possess a specific 60-MDa EHEC plasmid are known as EHEC [8, 9]. One feature EHEC and EPEC have in common is the causation of intestinal epithelial lesions known as A/E. AEEC is a designation for those E. coli strains known to cause A/E lesions or at least carry the genes for this trait, and therefore include organisms that fall into either the EHEC or EPEC classes. Because cattle are carriers of many different serotypes of EHEC, much emphasis has been placed on the public health and food safety concerns associated with the fecal shedding of these organisms. However, much less emphasis has been given to their roles as diarrheagenic pathogens of cattle [8, 9]. In fact, several pathotypes of E. coli have been known by presence of certain genes. EAF and bfp are predominant in EPEC and typical genes of EAEC (pAA), cdt and cnf are the major genes of NTEC and finally sta, stb, lt, f4, f5, f18, stx1 and szx2 are the genes of the EHEC pathotype [8, 9].

EHEC strains are a subset of STEC strains [3, 7]. Infection with STEC strains can result in a spectrum of outcomes, ranging from asymptomatic carriage to uncomplicated diarrhea, bloody diarrhea, hemolytic uremic syndrome (HUS), thrombocytopenia, hemolytic anemia, and acute renal failure [3, 7, 10]. Most outbreaks and sporadic cases of bloody and non-bloody diarrhea and HUS have been attributed to strains of the STEC serogroups including O157, O26, O103, O111, O145, O45, O91, O113, O121 and O128 [1115].

Heat-labile enterotoxins (LT) and heat-stable enterotoxins (STa or STb) are two of the most important bacterial virulence factors are able to causes severe diarrhea in calves [3, 10]. Also, there are some another virulence factors including phage-encoded cytotoxins, called Shiga toxin 1 (stx1) and Shiga toxin 2 (stx2), the protein intimin (eae) and the plasmid-encoded enterohaemolysin or enterohaemorrhagic E. coli haemolysin (ehly) which are related to the pathogenesis of STEC strains [16]. The NTEC are able to elaborate two types of cytotoxic necrotizing factors (CNF1 and CNF2). CNF factors are heat-labile proteins which can cause diarrhea. Cytolethal distending toxin (CDT) induces enlargement and death of some cultured eukaryotic cell lines and causing diarrhea. Totally, five different cdt alleles (cdt-I, cdt-II, cdt-III, cdt-IV and cdt-V) have been reported in E. coli strains [1721]. The 31A produces F17c fimbria (formerly called 20 K), which is responsible for N-acetyl-D-glucosamine-dependent adhesion of bacteria to calves border villi [5, 22]. The F17c includes fimbriae expressed by calf diarrheic [23, 24]. Studies in France, Scotland and Belgium showed that pathogenic F17-producing E. coli strains represent a significant part of the bacterial strains isolated from diarrheic calves [25].

Diseases caused by E. coli often require antimicrobial therapy; however, antibiotic-resistant strains of this bacterium cause longer and more severe illnesses than their antibiotic-susceptible counterparts. Several studies have shown that antibiotic resistance in E. coli has increased over time [2628]. Data on the distribution of serogroups, pathotypes, virulence genes and the antimicrobial resistance properties of E. coli strains isolated from diarrheic calves is scarce in Iran. Therefore, the aim of the present study was to characterize E. coli strains isolated from Iranian diarrheic calves at the molecule level and investigate their susceptibility to 13 commonly used antibiotics, as well as investigating seasonal variation in the prevalence and serogroup distribution of E. coli.

Results and discussion

We found that 630 out of 824 samples (76.45%) were positive for E. coli. Chaharmahal province had the highest incidence of E. coli in diarrhea specimens (84.61%), while Isfahan province had the lowest incidence (71.95%).

Distribution of various pathotypes is shown in Table 1. We found that the incidence of ETEC, EHEC, AEEC and NTEC pathotypes were 28.41%, 5.07%, 29.52% and 3.49%, respectively. In addition, 33.49% diarrheic samples were diagnosed as non detected. We found significant differences between the incidence of ETEC and NTEC (P = 0.017), ETEC and EHEC (P = 0.023), AEEC and NTEC (P = 0.015) and AEEC and EHEC (P = 0.021) pathotypes of E. coli. Lt and K99 (F5) genes were detected in all of the ETEC pathotype, while the st gene was detected in 4.46% of them. F41 gene was detected in 72 samples of the EHEC pathotype (40.22%), included all stx1, eae, ehly genes, while the distribution of stx1, stx2 and eae genes in AEEC pathotype were 96.23%, 56.98% and 51.07%, respectively. In addition, 91 samples (48.92%) had both stx1 and eae, 61 (32.79%) samples had both stx2 and eae and 34 (18.27%) had all stx1, stx2 and eae genes. Furthermore, both cnf1 and hlyA genes were detected in 14 (63.63%), both cnf2 and hlyA genes in 6 (27.27%), all cnf1, cnf2 and hlyA genes in 4 (18.18%), all cnf1, cnf2, hlyA and cdtIII genes in 4 (18.18%), all cnf1, hlyA and f17c genes in 2 (9.09%), all nf2, hlyA and f17c genes in 2 (9.09%), all cnf2, hlyA and cdtIII genes in 20 (90.90%) and finally, all cnf2, hlyA, cdtIII and f17c genes in 5 (22.72%) of NTEC pathotypes (Table 1). We also found significant differences between the incidences of lt and st (P = 0.033), f5 and f41 (P = 0.048), stx1 and stx2 (P = 0.046) and stx1 and eae (P = 0.038) genes.
Table 1

Prevalence of virulence genes in E. coli pathotypes isolated from diarrheic calves

Pathotype

No. positive samples

Virulence gene

Non detected

211 (33.49%)

-

ETEC

179 (28.41%) A, B*

lt, F5: 179 (100%) A, B

lt, st, F5: 8(4.46%) a

F5, F41: 72 (40.22%) b

F5, lt: 179 (100%)

F41, lt: 67 (37.43%)

F41, st, lt: 4 (2.23%)

EHEC

32 (5.07%) a, c

stx1, eae, ehly: 32 (100%)

AEEC

186 (29.52%) C, D

stx1: 179 (96.23%) A

stx2: 106 (56.98%) a

eae: 95 (51.07%) a

stx1, ea e: 91 (48.92%)

stx2, eae: 61 (32.79%)

stx1, stx2, eae: 34 (18.27%)

NTEC

22 (3.49%) b, d

cnf1, hlyA: 14 (63.63%)

cnf2, hlyA: 6 (27.27%)

cnf1, cnf2, hlyA: 4 (18.18%)

cnf1, cnf2, hlyA, cdtlll: 4 (18.18%)

cnf1, hlyA, f17c: 2 (9.09%)

cnf2, hlyA, f17c: 2 (9.09%)

cnf2, hlyA, cdtlll: 20 (90.90%)

cnf2, hlyA, cdtlll, f17c: 5 (22.72%)

Total

630 (76.45%)

 

*Similar capital and small letters in column have a significant differences about P <0.05.

Seasonal distribution of E. coli pathotypes is shown in Table 2. Samples that were collected in the winter had the highest incidence of bacteria (54.92%), while those were collected in summer had the lowest incidence (2.53%). Our results showed significant differences (P = 0.018) for presences of E. coli strains between cold and warm seasons. The age distribution of the diarrheic calves with regard to infection with E. coli is shown in Table 3. We found that the 1–7 day-old calves had the highest incidence of E. coli (39.19%), while the 22–30 day-old calves had the lowest incidence (12.01%). Statistical analysis were significant for the incidence of E. coli strains between younger and older calves (P = 0.035 between 1–7 days old and 15–21 and P = 0.026 between 1–7 days old and 22–30).
Table 2

Prevalence of E. coli pathotypes isolated from diarrheic calves in different seasons and provinces

Province

Season

Non detected

ETEC

STEC

NTEC

No. pos. samples

Isfahan (246)

Autumn (84)

18

7

21

-

46

Winter (111) A*

39

53

1

9

102

Spring (35)

7

7

11

1

26

Summer (16) a

1

-

2

-

3

Chaharmahal (182)

Autumn (61) C

23

9

18

3

53

Winter (95) B

37

42

11

1

91

Spring (17)

1

1

-

1

3

Summer (9) b, c

2

1

4

-

7

Fars (208)

Autumn (84) E

22

6

33

2

63

Winter (94) D

22

10

35

2

69

Spring (20)

5

16

1

-

22

Summer (10) d, e

-

3

-

-

3

Khozestan (188)

Autumn (63) G

5

1

25

3

34

Winter (86) F

23

13

48

-

84

Spring (30)

5

8

8

-

21

Summer (9) f, g

1

2

-

-

3

Total (824)

Autumn (292) C

68

23

97

8

196

Winter (386) H

121

118

105

12

346

Spring (102)

28

32

10

2

72

 

Summer (44) h, i

4

6

6

-

16

*Similar capital and small letters in column have a significant differences about P <0.05.

Table 3

Prevalence of E. coli pathotypes isolated from diarrheic calves in different ages and provinces

Province

Age (day)

Non detected

ETEC

STEC

NTEC

No. pos. samples

Isfahan (246)

1-7 A*

36

42

10

-

88

8-14

14

6

18

1

39

15-21 a

1

3

23

2

29

22-30 a

1

2

14

4

21

Chaharmahal (182)

1-7 B

33

29

9

-

71

8-14

10

6

18

2

36

15-21 b

1

2

18

3

24

22-30 b

1

1

17

4

23

Fars (208)

1-7 C

38

37

7

-

82

8-14 D

21

5

10

-

36

15-21 c,d

1

4

17

1

23

22-30 c,d

2

1

12

1

16

Khozestan (188)

1-7 E

36

36

6

-

78

8-14

15

3

13

1

32

15-21 e

1

1

10

1

13

22-30 e

-

1

16

2

19

Total (824)

1-7 F

143

144

32

-

319

8-14

60

20

59

4

143

15-21 f

4

10

68

7

89

 

22-30 f

4

5

59

11

79

*Similar capital and small letters in column have a significant differences about P < 0.05.

Antimicrobial resistance of E. coli pathotypes isolated from the diarrheic calves is shown in Table 4. Bacterial strains exhibited the highest level of resistance to penicillin (100%), followed by streptomycin (98.25%), tetracycline (98.09%), lincomycin (92.69%) and sulfamethoxazol (90.31%), while STEC and ETEC had the highest resistance profiles overall. Totally, the E. coli strains of our investigation had the lowest resistance to nitrofurantoin (23.96%) and cephalothin (52.06%). There were significant differences between resistance of E. coli strains to penicillin and nitrofurantoin (P = 0.013), penicillin and cephalothin (P = 0.045), streptomycin and nitrofurantoin (P = 0.015), streptomycin and cephalothin (P = 0.050), tetracycline and nitrofurantoin (P = 0.018), lincomycin and nitrofurantoin (P = 0.026) and sulfamethoxazol and nitrofurantoin (P = 0.029).
Table 4

Antibiotic resistance profile of E. coli pathotypes isolated from diarrheic calves (Disk diffusion method)

 

P10*

TE30

S10

C30

SXT

GM10

NFX5

L2

CF30

CIP5

TMP5

F/M300

AM10

Non detected (211)

211

209

210

145

201

179

161

196

102

112

189

32

126

ETEC (179)

179

179

175

126

152

150

101

169

118

120

72

18

116

STEC (218)

218

208

214

192

198

167

123

201

106

146

123

96

202

NTEC (22)

22

22

20

2

8

6

2

18

2

2

8

5

4

Total (630)

630 (100%) A**

618 (98.09%) C

619 (98.25%) B

465 (73.80%)

559 (90.31%) E

502 (79.68%)

387 (61.42%)

584 (92.69%)

328 (52.06%) a,b

380 (60.31%)

392 (62.22%)

151 (23.96%) a,b,c,d,e

448 (71.11%)

*In this table P10 = penicillin (10 μ/disk); TE30 = tetracycline (30 μg/disk); S10 = streptomycin (10 μg/disk); C30 = chloramphenicol (30 μg/disk); SXT = sulfamethoxazol (25 μg/disk); GM10 = gentamycin (10 μg/disk); NFX5 = enrofloxacin (5 μg/disk); L2 = lincomycin (2 μg/disk); CF30 = cephalothin (30 μg/disk); CIP5 = ciprofloxacin (5 μg/disk); TMP5 = trimethoprim (5 μg/disk); F/M300 = nitrofurantoin (300 μg/disk); AM10 = ampicillin (10 μ/disk).

**Similar capital and small letters in rows have a significant differences about P <0.05.

The distribution of antimicrobial resistance genes within the bacterial pathotypes isolated from diarrheic calves is shown in Table 5. Genes that encode resistance to streptomycin, sulfonamide, gentamicin, ampicillin and trimethoprim antibiotics, i.e., aadA1, sul1, aac[3]-IV, CITM and dfrA1 were the most common antibiotic resistance genes in the diarrheic calves. Interestingly, we found that ETEC and STEC had the highest frequency of antibiotic resistance genes. Statistical analyses were significant between the incidence of aadA1 and cmlA (P = 0.018), aadA1 and qnr (P = 0.024), aadA1 and cat1 (P = 0.028), sul1 and cmlA (P = 0.019), sul1 and cat1 (P = 0.029) and sul1 and qnr (P = 0.031) antibiotic resistance genes.
Table 5

Distribution of antibiotic resistance genes of E. coli pathotypes isolated from diarrheic calves in different provinces

 

Province

aadA1

tetA

tetB

dfrA1

qnr

aac (3) -IV

sul1

blaSHV

CITM

cat1

cmlA

Non detected (211)

Isfahan (63)

57

23

16

46

10

61

56

49

54

15

7

Chaharmahal (59)

58

18

22

49

14

56

59

11

48

10

3

Fars (44)

38

21

16

38

2

40

42

9

41

-

10

Khozestan (45)

43

37

37

35

3

13

41

12

43

5

4

ETEC (179)

Isfahan (46)

44

36

13

18

5

45

42

28

31

20

7

Chaharmahal (36)

34

22

19

17

6

32

29

26

30

26

6

Fars (44)

39

30

14

14

2

29

32

25

31

13

7

Khozestan (53)

52

14

17

14

3

36

41

13

9

7

6

SETC (218)

Isfahan (62)

58

30

32

36

32

43

52

20

49

14

-

Chaharmahal (58)

55

28

26

29

36

49

56

29

52

16

36

Fars (59)

56

14

16

32

16

46

51

29

55

-

40

Khozestan (39)

33

26

24

23

17

31

33

8

36

2

18

NTEC (22)

Isfahan (6)

4

2

1

3

2

1

8

1

3

-

1

Chaharmahal (1) a*

1

-

1

1

-

-

1

-

1

-

-

Fars (10) A

10

6

-

1

3

1

3

-

1

-

-

Khozestan (5)

2

2

2

1

1

1

2

-

1

-

-

Total

Isfahan (177) A

163A

91

62

103

49a,b

150

158B

98

137

49a,b

15a,b

Chaharmahal (154)

148C

68

68

96

56c

137

145

66

131

52c

45

Fars (157)

143D

71

46

85

23d

116

128

63

128

13d

50

 

Khozestan (142) a

130E

79

80

73

24e

81

117

33

89

14e

28

*Similar capital and small letters in rows have a significant differences about P <0.05.

Incidence of STEC O-serogroups in diarrheic calves is shown in Table 6. O26 (26.60%) had the highest incidence, followed by O157 (14.67%). In addition, the serogroups of 19 samples (8.71%) cannot be detected. The results of our study showed significant difference between the presence of O26 and O113 (P = 0.014), O26 and O121 (P = 0.016), O26 and O45 (P = 0.020), O26 and O128 (P = 0.022), O26 and O145 (P = 0.027), O157 and O113 (P = 0.018) O157 and O121 (P = 0.021) and O157 and O45 (P = 0.025) serogroup in calves with diarrhea. The distribution of virulence factors, O-serogroups and antibiotic resistance genes in non-pathogenic E. coli strains were lower than those of pathogenic strains. Also, non-pathogenic strains of bacteria were more susceptible to tested antibiotics than pathogenic bacteria.
Table 6

Prevalence of STEC serogroups isolated from diarrheic calves in different provinces

Province

0157

026

0103

0111

0145

045

091

0113

0121

0128

Non detected

Isfahan (62)

16

16

-

3

4

2

8

6

-

4

3

Chaharmahal (58)

2

-

6

7

8

10

10

-

3

6

6

Fars (59)

10

28

9

-

2

-

6

-

-

-

4

Khozestan (39)

4

14

-

6

-

-

2

-

4

3

6

Total (218)

32B*

58A

15

16

14a

12a,b

26

6a,b

7a,b

13a

19

*Similar capital and small letters in rows have a significant differences about P <0.05.

The high importance of geographical area and season on the incidence of E. coli strains in diarrheic calves were addressed in the present study. Similar results have been reported by Mohamed Ou Said et al. [29]. Season and geography are also known to influence passive transfer of colostral immunoglobulins in calves [30]. Season has a significant effect on the calf mortality [31] as well as on the absorption of immunoglobulins in neonatal calves. One possible explanation for the high prevalence of E. coli strains in calves in winter is that climatic variables such as heat, rain and thunderstorms, together with variable barometric pressure may have affected the autonomic nervous systems. These variables could affect immunity, thus making calves more susceptible to infections. Alternatively, the higher prevalence of E. coli strains in winter in our study may be related to the fact that the mean serum IgG1 concentrations were low in winter born calves and increased during the spring and summer [32]. The higher mortality rates of 69.6% and 15.36% were observed in winter born calves than 39.4% and 5.97% in summer born calves of Afzal et al. [33] and Sharma et al. [34] investigations. Similar results have been reported previously [35, 36].

To the best of our knowledge, this is the first and most comprehensive report on serogroups, pathotypes, virulence genes and antimicrobial resistance properties in E. coli strains isolated from diarrheic calves in Iran. Totally, the prevalence of E. coli strains isolated from calves with diarrhea in Iran (76.45%, our results) was significantly higher than Egypt (10.36%) [37] and India (42.65%). Mora et al. [38] reported that 12% of the calves and 22% of the farms samples were positive for highly virulent STEC serotype O157:H7. Unfortunately, there were limited investigations related to distribution of E. coli bacterium and its pathotypes, serogroups, virulence factors and antibiotic resistance properties.

Another important finding relates to the distributions of several bacterial virulence factors in the diarrheic calves of our investigation. A Brazilian study [39] showed that 49.75% of E. coli-positive diarrheic samples was toxigenic and the most prevalent virulence genes were stx1 (9.7%), stx2 (6.3%), α-hemolysin (9.7%), ehly (6.8%), cnf1 (0.5%), LT-II (8.3%) and STa (3.9%). Nguyen et al. [3] reported that 31.30% of E. coli strains of diarrheic calves had one of the fimbrial genes. They revealed that the incidence of shiga toxin genes, enterotoxins and eae gene were 46.29%, 0.92%, and 31.48%, respectively.

Herrera-Luna et al. [40] revealed that 17% of all diarrheic and healthy calves of Australian herds were infected by E. coli. They showed that 15.2% of E. coli strains harbored the shiga toxin genes including stx1, stx2 and ehly and eae genes. Low incidence of VTEC phenotype and O157:H7 serotypes of E. coli strains of diarrheic calves of Najaf, Iraq were reported by Al-Charrakh and Al-Muhana [41]. Diarrheic calves of Bradford et al. [42] investigation hadn’t any cnf1, cnf2, stx2, stB and lt genes, while the K99 fimbriae, stA enterotoxin, stx1 and eae genes were detected in 8, 8, 1 and 1 isolates, respectively which was lower than our result. It seems that stx1, stx2, eae, ehly, hlyA, lt, st, cnf1, cnf2, cdtIII and f17c virulence genes are predominant in E. coli strains isolated from calves with diarrhea.

In the present study, 211 E. coli strains that were isolated from diarrheic samples hadn’t any virulence factors. One possible explanation for this finding is the fact that maybe these strains were non-pathogenic E. coli and the animals have diarrhea caused by some other infectious agent. Achá et al. [43] reported that 76% of calves were infected with E. coli, while the prevalence of other causative agents including Salmonella species and Campylobacter species were 2% and 11%, respectively. They also reported that 22/55 (40%) strains from diarrheal calves and 14/88 (16%) strains from healthy calves carried the K99 adhesin (P = 0.001).

Our results showed that O26 and O157 were the most common serogroups of our study, while O113 and O121 were the less common. Saridakis et al. [44] showed that O26, O114 and O119 were the most prevalent serogroups in E. coli strains isolated from diarrheic calves. Mora et al. [38] showed that 52% of E. coli strains isolated from bovine herds were belonged to O26, O22, O77, O4, O105, O20, O157, O113, and O171 serogroups which was similar to our results.

Bloody diarrhea, non-bloody diarrhea, HUS and other clinical complications of infection with STEC strains are serious among calves, compelling clinicians to consider the provision of early, and empirical antibiotic therapy. However, current recommendations and the available data (although limited in scope and only formally studied for O157 and non-O157-related infections in calves) suggest that antibiotics should be withheld if STEC infection is suspected, given concerns that antibiotics may trigger release of stx and progression to diarrhea, resulting in worse clinical outcomes. Furthermore, because inappropriate prescriptions of antibiotics select antibiotic resistance, it was not surprising that our study found that resistance to some antibiotic agents was higher than 80%. The E. coli strains of our study were resistant to penicillin (100%), streptomycin (98.25%), tetracycline (98.09%), lincomycin (92.69%), sulfamethoxazol (90.31%), gentamycin (79.68%), chloramphenicol (73.8%), ampicillin (71.11%), trimethoprim (62.22%), enrofloxacin (61.42%) and ciprofloxacin (60.31%). In terms of antibiotic resistance genes, aadA1, sul1, aac[3]-IV, CITM and dfrA1 were the most commonly detected.

Totally, 73.8% of the STEC strains of our study were resistance to chloramphenicol. Chloramphenicol is a banned antibiotic and the high antibiotic resistance to this drug detected in our study indicates that irregular and unauthorized use of it may have occurred in Iran. Unfortunately, veterinarians in many fields of veterinary such as large animal internal medicine, poultry and even aquaculture, use this antibiotic as a basic one. Therefore, in a short period of time, antibiotic resistance will appear. Previous study showed that in some countries 300,000 kg of antibiotics is used yearly on veterinary prescription in animals [45].

Multidrug resistance of E. coli strains have been reported previously [46, 47]. Rigobelo et al. [47] reported that the E. coli strains had the highest resistance to cephalothin (46.1%), followed by tetracycline (45.7%), trimethoprim-sulfadiazine (43.3%) and ampicilin (41.0%). Multiple resistances of E. coli isolates to beta-lactams antibiotics including expanded-spectrum aminoglycosides, cephalosporins, tetracycline sulphonamides, and fluoroquinolones have been reported previously [42]. De Verdier et al. [48] showed that the E. coli strains were resistant to sulphonamide, streptomycin, ampicillin and tetracycline. They reported that 61% of all strains were resistant to more than one antibiotic. Similar investigations have been reported from Sweden [48], United State [49] and Czech [50].

The above data highlight large differences in the prevalence of STEC strains in the different studies, as well as differences in virulence genes and antibiotic resistance properties in the clinical samples. This could be related to differences in the type of samples tested, number of samples, method of sampling, experimental methodology, geographical area, antibiotic prescription preference among clinicians, antibiotic availability, and climate differences in the areas where the samples were collected, which would have differed between each study.

Conclusion

In conclusion, we identified a large number of pathotypes, serogroups, virulence factors and antibiotic resistance genes and resistance to more than one antibiotic in the E. coli strains isolated from diarrheic calves in Iran. Our data indicate that O26 and O157 serogroups are predominant in Iranian diarrheic calves. Marked seasonal, senile and geographical variation was also found. Our data revealed that the O26 serogroup, the lt, f5, f41, stx1, stx2, eaeA and hlyA putative virulence genes, the aadA1, sul1, aac[3]-IV, CITM and dfrA1 antibiotic resistance genes, and resistance to penicillin, streptomycin, tetracycline, lincomycin, sulfamethoxazol, gentamycin, chloramphenicol, ampicillin, trimethoprim, enrofloxacin and ciprofloxacin were the most commonly detected characteristics of E. coli strains isolated from Iranian diarrheic calves. Hence, judicious use of antibiotics is required by clinicians. We suggested use of disk diffusion method.

Methods

Samples and E. coli identification

Totally, 824 fecal samples of diarrheic calves were collected randomly during January 2010 to January 2011. Geographical distribution (Isfahan, Chaharmahal, Fars and Khuzestan provinces) (Figure 1), season of samples collection (spring, summer, autumn and winter) and age of diarrheic calves (2 to 30 days) were recorded during sampling. Fecal samples were taken using sterile rectal swabs. All swab samples were placed into tubes containing Stuart medium (Merck, Germany). Samples were immediately transferred to the Microbiology and Infectious Diseases Research Center of the Islamic Azad University of Shahrekord. All samples were diluted in phosphate buffered saline (PBS, Merck, Germany). Then samples were cultured on MacConkey’s agar (MC, Merck, Germany) (24 h at 37°C). Lactose positive colonies were cultured on Eosin Methylene Blue (EMB, Merck, Germany) (24 h at 37°C). Metallic green colonies were considered as E. coli. Several biochemical tests including Triple Sugar Iron Agar (TSI), Indole, Citrate utilization, Voges-Proskauer, urease and Methyl red tests were used for E. coli confirmation. All isolates were stored at -70°C in lactose broth (Merck, Germany) restraining 20% glycerol for further description.
Figure 1

Geographical areas of sample collection.

DNA extraction

All E. coli isolates were cultured on Peptone Water (PW, Merck, Germany) (24 h at 37°C). One hundred and fifty microliter of cultured PW media was added to 400 μL sterile distilled water. All components were boiled for 12 min. The mentioned suspension was frozen and then centrifuged at at 14,000 rpm for 14 min [51].

Detection of virulence genes, antibiotic resistance genes and serogroups using Polymerase Chain Reaction (PCR)

The method of Sabat et al. [52] was used in order to E. coli confirmation. Several PCR protocols were used to study the presence of virulence genes, serogroups and antibiotic resistance properties of STEC strains. List of primers used for this instance is shown in Table 7. PCR conditions including temperature and volume of each reaction is shown in Table 8. All reactions were performed using the PCR thermocycler (Eppendrof Mastercycler 5330; Eppendorf-Nethel-Hinz GmbH, Hamburg, Germany). Amplified PCR products were electrophoresed on 1.5% agarose gel stained with ethidium bromide. Final products were examined using the gen documentation system. Distilled water and E. coli CAPM 5933, CAPM 6006, O159:H20 and O157:K88ac:H19 were used as negative and positive controls, respectively.
Table 7

Oligonucleotid primers used for detection of virulence factors, serogroups and antibiotic resistance genes in STEC strains isolated from calves with diarrhea

Primer name

Sequence (5’-3’)

Size of product (bp)

Target gene

References

Hly-F

GAGCGAGCTAAGCAGCTTG

889

hlyEHEC

[6]

Hly-R

CCTGCTCCAGAATAAACCACA

Stx1-F

CAGTTAATGTGGTGGCGAAGG

348

Stx1

[53]

Stx1-R

CACCAGACAATGTAACCGCTG

Stx2-F

ATCCTATTCCCGGGAGTTTACG

584

Stx2

[53]

Stx2-R

GCGTCATCGTATACACAGGAGC

Eae-F

TGCGGCACAACAGGCGGCGA

629

eae

[6]

Eae-R

CGGTCGCCGCACCAGGATTC

Cnf1-F

GGGGGAAGTACAGAAGAATTA

1111

cnf1

[21]

Cnf1-R

TTGCCGTCCACTCTCTCACCAGT

Cnf2-F

TATCATACGGCAGGAGGAAGCACC

1240

cnf2

[21]

Cnf2-R

GTCACAATAGACAATAATTTTCCG

Cdt3-F

GAAAATAAATGGAATATAAATGTCCG

555

cdt-III

[21]

Cdt3-R

TTTGTGTCGGTGCAGCAGGGAAAA

F17c-F

GCAGGAACCGCTCCCTTGGC

416

f17c

[23]

F17c-R

CAACTAACGGGATGTACAGTTTC

LT-F

GCACACGGAGCTCCTCAGTC

218

ltII

[53]

LT-R

TCCTTCATCCTTTCAATGGCTTT

ST-F

AGGAACGTACATCATTGCCC

521

st

[54]

ST-R

CAAAGCATGCTCCAGCACTA

O26-F

CAG AAT GGT TAT GCT ACT GT

423

wzx

[55]

O26-R

CTT ACA TTT GTT TTC GGC ATC

O103-F

TTGGAGCGTTAACTGGACCT

321

wzx

[55]

O103-R

GCTCCCGAGCACGTATAAG

O111-F

TAG AGA AAT TAT CAA GTT AGT TCC

406

wzx

[55]

O111-R

ATA GTT ATG AAC ATC TTG TTT AGC

O145-F

CCATCAACAGATTTAGGAGTG

609

wzx

[55]

O145-R

TTTCTACCGCGAATCTATC

O157-F

CGG ACA TCC ATG TGA TAT GG

259

wzx

[55]

O157-R

TTG CCT ATG TAC AGC TAA TCC

O45-F

CCG GGT TTC GAT TTG TGA AGG TTG

527

wzx1

[56]

O45-R

CAC AAC AGC CAC TAC TAG GCA GAA

O91-F

GCTGACCTTCATGATCTGTTGA

291

gnd

[57]

O91-R

TAATTTAACCCGTAGAATCGCTGC

O113-F

GGGTTAGATGGAGCGCTATTGAGA

771

wzx

[12]

O113-R

AGGTCACCCTCTGAATTATGGCAG

O121-F

TGGCTAGTGGCATTCTGATG

322

wzx

[58]

O121-R

TGATACTTTAGCCGCCCTTG

O128-F

GCTTTCTGCCGATATTTGGC

 

galF

[59]

O128-R

CCGACGGACTGATGCCGGTGATT

aadA1-F

TATCCAGCTAAGCGCGAACT

447

Streptomycin resistance

[60]

aadA1-R

ATTTGCCGACTACCTTGGTC

tetA- F

GGTTCACTCGAACGACGTCA

577

Tetracycline resistance

[60]

tetA- R

CTGTCCGACAAGTTGCATGA

tetB- F

CCTCAGCTTCTCAACGCGTG

634

Tetracycline resistance

[60]

tetB- R

GCACCTTGCTGATGACTCTT

dfrA1- F

GGAGTGCCAAAGGTGAACAGC

367

Trimethoprim resistance

[61]

dfrA1- R

GAGGCGAAGTCTTGGGTAAAAAC

Qnr- F

GGGTATGGATATTATTGATAAAG

670

Fluoroquinolone resistance

[62]

Qnr- R

CTAATCCGGCAGCACTATTTA

aac [3] -IV- F

CTTCAGGATGGCAAGTTGGT

286

Gentamicin resistance

[63]

aac [3] -IV- R

(TCATCTCGTTCTCCGCTCAT

Sul1- F

TTCGGCATTCTGAATCTCAC

822

Sulfonamide resistance

[63]

Sul1- R

ATGATCTAACCCTCGGTCTC

blaSHV- F

TCGCCTGTGTATTATCTCCC

768

Cephalothin resistance

[63]

blaSHV- R

CGCAGATAAATCACCACAATG

CITM- F

TGGCCAGAACTGACAGGCAAA

462

Ampicillin resistance

[63]

CITM- R

TTTCTCCTGAACGTGGCTGGC

ereA- F

GCCGGTGCTCATGAACTTGAG

419

Erythromycin resistance

[63]

ereA- R

CGACTCTATTCGATCAGAGGC

cat1- F

AGTTGCTCAATGTACCTATAACC

547

Chloramphenicol resistance

[63]

cat1- R

TTGTAATTCATTAAGCATTCTGCC

cmlA-F

CCGCCACGGTGTTGTTGTTATC

698

Chloramphenicol resistance

[63]

cmlA-R

CACCTTGCCTGCCCATCATTAG

   
Table 8

PCR programs (temperature and volume) for detection of STEC O-serogroups, virulence factors and antibiotic resistance genes

Gene

PCR program

PCR volume (50 μL)

O157, O145, O103, O26, O111

1 cycle:

 

95°C ------------ 3 min.

5 μL PCR buffer 10X

30 cycle:

1.5 mM Mgcl2

95°C ------------ 20 s

200 μM dNTPe

58°C ------------ 40 s

0.5 μM of each primers F & R

72°C ------------ 30 s

1.25 U Taq DNA polymerasee

1 cycle:

2.5 μL DNA template

72°C ------------ 8 min

 

O91, O128, O121, O113, O45

1 cycle:

 

94°C ------------ 6 min.

5 μL PCR buffer 10X

34 cycle:

2 mM Mgcl2

95°C ------------ 50 s

150 μM dNTP

58°C ------------ 70 s

0.75 μM of each primers F & R

72°C ------------ 55 s

1.5 U Taq DNA polymerase

1 cycle:

3 μL DNA template

72°C ------------ 10 min

 

LT, ST

1 cycle:

 

94°C ------------ 6 min.

5 μL PCR buffer 10X

34 cycle:

1.5 mM Mgcl2

95°C ------------ 50 s

200 μM dNTP

56°C ------------ 70 s

0.5 μM of each primers F & R

72°C ------------ 50 s

1 U Taq DNA polymerase

1 cycle:

4 μL DNA template

72°C ------------ 6 min

 

stx1, stx2, eae, hly, cnf1, cnf2, cdtIII, f17c

1 cycle:

 

95°C ------------ 3 min.

5 μL PCR buffer 10X

34 cycle:

2 mM Mgcl2

94°C ------------ 60 s

200 μM dNTP

56°C ------------ 45 s

0.5 μM of each primers F & R

72°C ------------ 60 s

1.5 U Taq DNA polymerase

1 cycle:

5 μL DNA template

72°C ------------ 10 min

 

aadA1, tetA, tetB, dfrA1, qnr, Sul1, aac[3]-IV, blaSHV, CITM, cat1, cmlA

1 cycle:

 

94°C ------------ 8 min.

5 μL PCR buffer 10X

32 cycle:

2.5 mM Mgcl2

95°C ------------ 60 s

200 μM dNTP

55°C ------------ 70 s

0.5 μM of each primers F & R

72°C ------------ 2 min

2 U Taq DNA polymerase

1 cycle:

3 μL DNA template

 

72°C ------------ 8 min

 

Antibiotic susceptibility testing

The Kirby–Bauer disc diffusion method based on the laboratory protocol of the Clinical and Laboratory Standards Institute [64] was used for study the antibiotic susceptibility pattern of E. coli isolates. All isolates were cultured on Mueller–Hinton agar in an aerobic condition (Merck, Germany) (24 h at 37°C). Susceptibility of E. coli isolates to commonly used antibiotic agents was measured and interpreted based on the CLSI protocol. E. coli ATCC 25922 was used as quality control.

Statistical analysis

The SPSS (Statistical Package for the Social Sciences) software (Ver. 16) and Chi-square and Fisher's exact tests were used in order to study the statistical relationship between the incidence of bacterium in various age, season and geographical regions and also between the frequency of various virulence factors, pathotypes, antibiotic resistance genes and serogroups. A P value < 0.05 was considered statistically significant.

Declarations

Acknowledgements

These present work was done in the Microbiology laboratory, Islamic Azad University, Shahrekord Branch, Sharekord, Iran. This work was supported by the Islamic Azad University, Shahrekord Branch-Iran. The authors would like to thank Dr. E. Tajbakhsh at the Biotechnology Research Center of the Islamic Azad University of Shahrekord, and Dr. Sh. Nejat Dehkordi at the department of Clinical Sciences, Islamic Azad University of Shahrekord for their important technical and clinical support.

Authors’ Affiliations

(1)
Young Researchers and Elites Club, Shahrekord Branch, Islamic Azad University
(2)
Department of Microbiology, College of Veterinary Medicine, Shahrekord Branch, Islamic Azad University

References

  1. Schroeder ME, Bounpheng MA, Rodgers S, Baker RJ, Black W, Naikare H, Velayudhan B, Sneed L, Szonyi B, Clavijo A: Development and performance evaluation of calf diarrhea pathogen nucleic acid purification and detection workflow. J Vet Diagn Invest 2012, 24(5):945-953.PubMedGoogle Scholar
  2. Sans P, De Fontguyon G: Veal calf industry economics. Rev Med Vet-Toulouse 2009, 160(8–9):420-424.Google Scholar
  3. Nguyen TD, Vo TT, Vu-Khac H: Virulence factors in Escherichia coli isolated from calves with diarrhea in Vietnam. J Vet Sci 2011, 12(2):159-164.PubMed CentralView ArticlePubMedGoogle Scholar
  4. Wani SA, Hussain I, Nabi A, Fayaz I, Nishikawa Y: Variants of eae and stx genes of atypical enteropathogenic Escherichia coli and non-O157 Shiga toxin-producing Escherichia coli from calves. Lett Appl Microbiol 2007, 45(6):610-615.View ArticlePubMedGoogle Scholar
  5. Arya G, Roy A, Choudhary V, Yadav MM, Joshi CG: Serogroups, atypical biochemical characters, colicinogeny and antibiotic resistance pattern of Shiga toxin-producing Escherichia coli isolated from diarrhoeic calves in Gujarat, India. Zoonoses Public Health 2008, 55(2):89-98.View ArticlePubMedGoogle Scholar
  6. Islam MA, Heuvelink AE, de Boer E, Sturm PD, Beumer RR, Zwietering MH, Faruque AS, Haque R, Sack DA, Talukder KA: Shiga toxin-producing Escherichia coli isolated from patients with diarrhoea in Bangladesh. J Med Microbiol 2007, 56(Pt 3):380-385.View ArticlePubMedGoogle Scholar
  7. Kaper JB, Nataro JP, Mobley HL: Pathogenic Escherichia coli . Nat Rev Microbiol 2004, 2(2):123-140.View ArticlePubMedGoogle Scholar
  8. Moxley RA, Smith DR: Attaching-effacing Escherichia coli infections in cattle. Vet Clin North Am Food Anim Pract 2010, 26(1):29-56.View ArticlePubMedGoogle Scholar
  9. Janke BH, Francis DH, Collins JE, Libal MC, Zeman DH, Johnson DD: Attaching and effacing Escherichia coli infections in calves, pigs, lambs, and dogs. J Vet Diagn Invest 1989, 1(1):6-11.View ArticlePubMedGoogle Scholar
  10. Kumar A, Taneja N, Singhi S, Sharma RSM: Haemolytic uraemic syndrome in India due to Shiga toxigenic Escherichia coli . J Med Microbiol 2012, 62(pt 1):157-160.PubMedGoogle Scholar
  11. Jenkins C, Pearce MC, Smith AW, Knight HI, Shaw DJ, Cheasty T, Foster G, Gunn GJ, Dougan G, Smith HR, Frankel G: Detection of Escherichia coli serogroups O26, O103, O111 and O145 from bovine faeces using immunomagnetic separation and PCR/DNA probe techniques. Lett Appl Microbiol 2003, 37(3):207-212.View ArticlePubMedGoogle Scholar
  12. DebRoy C, Roberts E, Kundrat J, Davis MA, Briggs CE, Fratamico PM: Detection of Escherichia coli serogroups O26 and O113 by PCR amplification of the wzx and wzy genes. Appl Environ Microbiol 2004, 70(3):1830-1832.PubMed CentralView ArticlePubMedGoogle Scholar
  13. Heijnen L, Medema G: Quantitative detection of E. coli, E. coli O157 and other shiga toxin producing E. coli in water samples using a culture method combined with real-time PCR. J Water Health 2006, 4(4):487-498.PubMedGoogle Scholar
  14. Erickson MC, Doyle MP: Food as a vehicle for transmission of Shiga toxin-producing Escherichia coli . J Food Prot 2007, 70(10):2426-2449.PubMedGoogle Scholar
  15. Lin A, Nguyen L, Lee T, Clotilde LM, Kase JA, Son I, Carter JM, Lauzon CR: Rapid O serogroup identification of the ten most clinically relevant STECs by Luminex microbead-based suspension array. J Microbiol Methods 2011, 87(1):105-110.View ArticlePubMedGoogle Scholar
  16. Law D: Virulence factors of Escherichia coli O157 and other Shiga toxin-producing E. coli. J Appl Microbiol 2000, 88(5):729-745.View ArticlePubMedGoogle Scholar
  17. Orth D, Grif K, Dierich MP, Würzner R: Cytolethal distending toxins in Shiga toxin-producing Escherichia coli : alleles, serotype distribution and biological effects. J Med Microbiol 2006, 55(Pt 11):1487-1492.View ArticlePubMedGoogle Scholar
  18. Bielaszewska M, Stoewe F, Fruth A, Zhang W, Prager R, Brockmeyer J, Mellmann A, Karch H, Friedrich AW: Shiga toxin, cytolethal distending toxin, and hemolysin repertoires in clinical Escherichia coli O91 isolates. J Clin Microbiol 2009, 47(7):2061-2066.PubMed CentralView ArticlePubMedGoogle Scholar
  19. Tóth I, Nougayrède JP, Dobrindt U, Ledger TN, Boury M, Morabito S, Fujiwara T, Sugai M, Hacker J, Oswald E: Cytolethal distending toxin type I and type IV genes are framed with lambdoid prophage genes in extraintestinal pathogenic Escherichia coli . Infect Immun 2009, 77(1):492-500.PubMed CentralView ArticlePubMedGoogle Scholar
  20. Janka A, Bielaszewska M, Dobrindt U, Greune L, Schmidt MA, Karch H: Cytolethal distending toxin gene cluster in enterohemorrhagic Escherichia coli O157:H- and O157:H7: characterization and evolutionary considerations. Infect Immun 2003, 71(6):3634-3638.PubMed CentralView ArticlePubMedGoogle Scholar
  21. Tóth I, Hérault F, Beutin L, Oswald E: Production of cytolethal distending toxins by pathogenic Escherichia coli strains isolated from human and animal sources: establishment of the existence of a new cdt variant (Type IV). J Clin Microbiol 2003, 41(9):4285-4291.PubMed CentralView ArticlePubMedGoogle Scholar
  22. Ghanbarpour R, Nazem MN: Prevalence of aerobactin and adhesin genes in Escherichia coli isolates from blood of bacteremic severely ill neonatal calves. Vet Arhiv 2010, 80(2):185-194.Google Scholar
  23. Bertin Y, Girardeau JP, Darfeuille-Michaud A, Martin C: Epidemiological study of pap genes among diarrheagenic or septicemic Escherichia coli strains producing CS31A and F17 adhesins and characterization of Pap(31A) fimbriae. J Clin Microbiol 2000, 38(4):1502-1509.PubMed CentralPubMedGoogle Scholar
  24. Pichon C, Héchard C, du Merle L, Chaudray C, Bonne I, Guadagnini S, Vandewalle A, Le Bouguénec C: Uropathogenic Escherichia coli AL511 requires flagellum to enter renal collecting duct cells. Cell Microbiol 2009, 11(4):616-628.View ArticlePubMedGoogle Scholar
  25. De Boer E, Heuvelink AE: Methods for the detection and isolation of Shiga toxin-producing Escherichia coli . Symp Ser Soc Appl Microbiol 2000, 29: 133S-143S.View ArticlePubMedGoogle Scholar
  26. Solomakos N, Govaris A, Angelidis AS, Pournaras S, Burriel AR, Kritas SK, Papageorgiou DK: Occurrence, virulence genes and antibiotic resistance of Escherichia coli O157 isolated from raw bovine, caprine and ovine milk in Greece. Food Microbiol 2009, 26(8):865-871.View ArticlePubMedGoogle Scholar
  27. Cortés P, Blanc V, Mora A, Dahbi G, Blanco JE, Blanco M, López C, Andreu A, Navarro F, Alonso MP, Bou G, Blanco J, Llagostera M: Isolation and characterization of potentially pathogenic antimicrobial-resistant Escherichia coli strains from chicken and pig farms in Spain. Appl Environ Microbiol 2010, 76(9):2799-2805.PubMed CentralView ArticlePubMedGoogle Scholar
  28. Tadesse DA, Zhao S, Tong E, Ayers S, Singh A, Bartholomew MJ, McDermott PF: Antimicrobial drug resistance in Escherichia coli from humans and food animals, United States, 1950–2002. Emerg Infect Dis 2012, 18(5):742-749.View ArticleGoogle Scholar
  29. Mohamed Ou Said A, Contrepois M, Der Vartanian M, Girardeau JP: Factors and markers of virulence of Escherichia coli strains isolated from diarrhea in calves aged 4–45 days in Algeria. Rev Elev Med Vet Pays Trop 1994, 47(2):169-175.PubMedGoogle Scholar
  30. Snodgrass DR, Terzolo HR, Campbell D, Sherwood I, Menzies JD, Synge BA: Aetiology of diarrhoea in young calves. Vet Rec 1986, 119: 31-34.View ArticlePubMedGoogle Scholar
  31. Fink T: Influence of type of housing, microclimate and management on health of calves. Hannover: Inaugural Disser Tierarztliche Hochshule; 1980.Google Scholar
  32. Norheim K, Simensen E, Gjestang KE: The relationship between serum IgG levels and age, leg injuries, infections and weight gains in dairy calves. Nordisk Vet Med 1985, 37: 113-120.Google Scholar
  33. Afzal M, Javed MH, Anjum AD: Calf mortality: seasonal pattern, age distribution and causes of mortality. Pak Vet J 1983, 3: 30-33.Google Scholar
  34. Sharma MC, Pathak NN, Hung NN, Lien NH, Vuc NV: Mortality in growing Murrah buffalo calves in Vietnam. Indian J Anim Sci 1984, 54: 998-1000.Google Scholar
  35. Bhullar MS, Tiwana MS: Factors affecting mortality among buffalo calves. Indian J Anim Sci 1985, 55: 599-601.Google Scholar
  36. Varma AK, Sastry NSR, Kar D: Mortality trends in female Murrah buffalo calves. Indian J Anim Product Managem 1988, 4: 18-21.Google Scholar
  37. Younis EE, Ahmed AM, El-Khodery SA, Osman SA, El-Naker YF: Molecular screening and risk factors of enterotoxigenic Escherichia coli and Salmonella spp. in diarrheic neonatal calves in Egypt. Res Vet Sci 2009, 87(3):373-379.View ArticlePubMedGoogle Scholar
  38. Mora A, Herrrera A, López C, Dahbi G, Mamani R, Pita JM, Alonso MP, Llovo J, Bernárdez MI, Blanco JE, Blanco M, Blanco J: Characteristics of the Shiga-toxin-producing enteroaggregative Escherichia coli O104:H4 German outbreak strain and of STEC strains isolated in Spain. Int Microbiol 2011, 14(3):121-141.PubMedGoogle Scholar
  39. Salvadori MR, Valadares GF, da Silva LD, Blanco J, Yano T: Virulence factors of Escherichia coli isolated from calves with diarrhea in Brazil. Braz J Microbiol 2003, 34(3):230-235.View ArticleGoogle Scholar
  40. Herrera-Luna C, Klein D, Lapan G, Revilla-Fernandez S, Haschek B, Sommerfeld-Stur I, Moestl K, Baumgartner W: Characterization of virulence factors in Escherichia coli isolated from diarrheic and healthy calves in Austria shedding various enteropathogenic agents. Vet Med 2009, 54: 1-11.Google Scholar
  41. Al-Charrakh A, Al-Muhana A: Prevalence of Verotoxin-producing Escherichia coli (VTEC) in a survey of dairy cattle in Najaf, Iraq. Iranian J Microbiol 2010, 2: 128-134.Google Scholar
  42. Bradford PA, Petersen PJ, Fingerman IM, White DG: Characterization of expanded-spectrum cephalosporin resistance in E. coli isolates associated with bovine calf diarrhoeal disease. J Antimicrob Chemother 1999, 44(5):607-610.View ArticlePubMedGoogle Scholar
  43. Achá SJ, Kühn I, Jonsson P, Mbazima G, Katouli M, Möllby R: Studies on calf diarrhoea in Mozambique: prevalence of bacterial pathogens. Acta Vet Scand 2004, 45(1–2):27-36.PubMed CentralView ArticlePubMedGoogle Scholar
  44. Saridakis HO, el Gared SA, Vidotto MC, Guth BE: Virulence properties of Escherichia coli strains belonging to enteropathogenic (EPEC) serogroups isolated from calves with diarrhea. Vet Microbiol 1997, 54(2):145-153.View ArticlePubMedGoogle Scholar
  45. van den Bogaard A: Veterinary use of antibiotics in the Netherlands. Facts and numbers. Tijdschr Diergeneeskd 2000, 125: 527-530.PubMedGoogle Scholar
  46. Khan A, Das SC, Ramamurthy T, Sikdar A, Khanam J, Yamasaki S, Takeda Y, Nair GB: Antibiotic resistance, virulence gene, and molecular profiles of Shiga toxin-producing Escherichia coli isolates from diverse sources in Calcutta, India. J Clin Microbiol 2002, 40(6):2009-2015.PubMed CentralView ArticlePubMedGoogle Scholar
  47. Rigobelo EC, Gamez HJ, Marin JM, Macedo C, Ambrosin JA, Ávila FA: Virulence factors of Escherichia coli isolated from diarrheic calves. Arq Bras Med Vet Zootec 2006, 58(3):305-310.View ArticleGoogle Scholar
  48. de Verdier K, Nyman A, Greko C, Bengtsson B: Antimicrobial resistance and virulence factors in Escherichia coli from Swedish dairy calves. Acta Vet Scand 2012, 54(1):2.PubMed CentralView ArticlePubMedGoogle Scholar
  49. Berge AC, Hancock DD, Sischo WM, Besser TE: Geographic, farm, and animal factors associated with multiple antimicrobial resistance in fecal Escherichia coli isolates from cattle in the western United States. J Am Vet Med Assoc 2010, 236(12):1338-1344.View ArticlePubMedGoogle Scholar
  50. Dolejská M, Senk D, Cízek A, Rybaríková J, Sychra O, Literák I: Antimicrobial resistant Escherichia coli isolates in cattle and house sparrows on two Czech dairy farms. Res Vet Sci 2008, 85(3):491-494.View ArticlePubMedGoogle Scholar
  51. Reischl U, Youssef MT, Kilwinski J, Lehn N, Zhang WL, Karch H, Strockbine NA: Real-time fluorescence PCR assays for detection and characterization of Shiga toxin, intimin, and enterohemolysin genes from Shiga toxin-producing Escherichia coli . J Clin Microbiol 2002, 40(7):2555-2565.PubMed CentralView ArticlePubMedGoogle Scholar
  52. Sabat G, Rose P, Hickey WJ, Harkin JM: Selective and sensitive method for PCR amplification of Escherichia coli 16S rRNA genes in soil. Appl Environ Microbiol 2000, 66: 844-849.PubMed CentralView ArticlePubMedGoogle Scholar
  53. Vidal M, Kruger E, Durán C, Lagos R, Levine M, Prado V, Toro C, Vidal R: Single multiplex PCR assay to identify simultaneously the six categories of diarrheagenic Escherichia coli associated with enteric infections. J Clin Microbiol 2005, 43(10):5362-5365.PubMed CentralView ArticlePubMedGoogle Scholar
  54. Arif SK, Salih LIF: Identification of different categories of diarrheagenic Escherichia coli in stool samples by using multiplex PCR technique. Asian J Med Sci 2010, 2(5):237-243.Google Scholar
  55. Possé B, De Zutter L, Heyndrickx M, Herman L: Metabolic and genetic profiling of clinical O157 and non-O157 Shiga-toxin-producing Escherichia coli . Res Microbiol 2007, 158(7):591-599.View ArticlePubMedGoogle Scholar
  56. DebRoy C, Fratamico PM, Roberts E, Davis MA, Liu Y: Development of PCR assays targeting genes in O-antigen gene clusters for detection and identification of Escherichia coli O45 and O55 serogroups. Appl Environ Microbiol 2005, 71(8):4919-4924.PubMed CentralView ArticlePubMedGoogle Scholar
  57. Perelle S, Dilasser F, Grout J, Fach P: Identification of the O-antigen biosynthesis genes of Escherichia coli O91 and development of a O91 PCR serotyping test. J Appl Microbiol 2002, 93(5):758-764.View ArticlePubMedGoogle Scholar
  58. Fratamico PM, Briggs CE, Needle D, Chen CY, DebRoy C: Sequence of the Escherichia coli O121 O-antigen gene cluster and detection of enterohemorrhagic E. coli O121 by PCR amplification of the wzx and wzy genes. J Clin Microbiol 2003, 41(7):3379-3383.PubMed CentralView ArticlePubMedGoogle Scholar
  59. Shao J, Li M, Jia Q, Lu Y, Wang PG: Sequence of Escherichia coli O128 antigen biosynthesis cluster and functional identification of an alpha-1,2-fucosyltransferase. FEBS Lett 2003, 553(1–2):99-103.View ArticlePubMedGoogle Scholar
  60. Randall LP, Cooles SW, Osborn MK, Piddock LJ, Woodward MJ: Antibiotic resistance genes, integrons and multiple antibiotic resistance in thirty-five serotypes of Salmonella enterica isolated from humans and animals in the UK. J Antimicrob Chemother 2004, 53(2):208-216.View ArticlePubMedGoogle Scholar
  61. Toro CS, Farfán M, Contreras I, Flores O, Navarro N, Mora GC, Prado V: Genetic analysis of antibiotic-resistance determinants in multidrug-resistant Shigella strains isolated from Chilean children. Epidemiol Infect 2005, 133(1):81-86.PubMed CentralView ArticlePubMedGoogle Scholar
  62. Mammeri H, Van De Loo M, Poirel L, Martinez-Martinez L, Nordmann P: Emergence of plasmid-mediated quinolone resistance in Escherichia coli in Europe. Antimicrob Agents Chemother 2005, 49(1):71-76.PubMed CentralView ArticlePubMedGoogle Scholar
  63. Van TT, Chin J, Chapman T, Tran LT, Coloe PJ: Safety of raw meat and shellfish in Vietnam: an analysis of Escherichia coli isolations for antibiotic resistance and virulence genes. Int J Food Microbiol 2008, 124(3):217-223.View ArticlePubMedGoogle Scholar
  64. CLSI (Clinical and Laboratory Standards Institute): Performance Standards for Antimicrobial Disk Susceptibility Tests, Approved standard-Ninth Edition (M2-A9). Wayne, PA: Clinical and Laboratory Standards Institute; 2006.Google Scholar

Copyright

© Shahrani et al.; licensee BioMed Central Ltd. 2014

This article is published under license to BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly credited. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated.